Transcript: Human XM_011513881.2

PREDICTED: Homo sapiens bone marrow stromal cell antigen 1 (BST1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BST1 (683)
Length:
2390
CDS:
1280..2062

Additional Resources:

NCBI RefSeq record:
XM_011513881.2
NBCI Gene record:
BST1 (683)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513881.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425495 ACCGACCAGTGAAGCTCTTAC pLKO_005 1893 CDS 100% 10.800 15.120 N BST1 n/a
2 TRCN0000425864 ACGAATCGAGATCTGGGTTAT pLKO_005 1765 CDS 100% 10.800 15.120 N BST1 n/a
3 TRCN0000430640 CAAGAAGTTAGTTCTATTTAG pLKO_005 2233 3UTR 100% 13.200 10.560 N BST1 n/a
4 TRCN0000051661 CCATCCTGACTGTGCCTTAAA pLKO.1 1933 CDS 100% 13.200 9.240 N BST1 n/a
5 TRCN0000051658 CCAAGTCTTTATACAGAACAA pLKO.1 1985 CDS 100% 4.950 3.465 N BST1 n/a
6 TRCN0000051662 CCATCCAGTATTCCAAGGATA pLKO.1 1632 CDS 100% 4.950 3.465 N BST1 n/a
7 TRCN0000051660 CCTACATCAGAAGACTGTGAA pLKO.1 1577 CDS 100% 4.950 3.465 N BST1 n/a
8 TRCN0000051659 GCAGCATGAAAGTCCTGGAAA pLKO.1 1827 CDS 100% 4.950 3.465 N BST1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513881.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05905 pDONR223 100% 81.2% 80.5% None (many diffs) n/a
2 ccsbBroad304_05905 pLX_304 0% 81.2% 80.5% V5 (many diffs) n/a
3 TRCN0000481623 TGAAAAATGATCCACTTTGTCCTC pLX_317 48% 81.2% 80.5% V5 (many diffs) n/a
Download CSV