Construct: ORF TRCN0000487718
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021031.1_s317c1
- DNA Barcode:
- CCACTACGGAGTACTTAACCTGAG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- GPR37L1 (9283)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487718
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9283 | GPR37L1 | G protein-coupled receptor ... | NM_004767.5 | 99.9% | 99.7% | 272A>G |
| 2 | human | 9283 | GPR37L1 | G protein-coupled receptor ... | XM_011510158.2 | 58.7% | 56.5% | (many diffs) |
| 3 | mouse | 171469 | Gpr37l1 | G protein-coupled receptor ... | NM_134438.3 | 86% | 90.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1515
- ORF length:
- 1443
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgcggtgg ctgtggcccc tggctgtctc tcttgctgtg attttggctg 121 tggggctaag cagggtctct gggggtgccc ccctgcacct gggcaggcac agagccgaga 181 cccaggagca gcagagccga tccaagaggg gcaccgagga tgaggaggcc aagggcgtgc 241 agcagtatgt gcctgaggag tgggcggagt acccccggcc cattcaccct gctggcctgc 301 agccaaccaa gcccttggtg gccaccagcc ctaaccccgg cagggatggg ggcaccccag 361 acagtgggca ggaactgagg ggcaatctga caggagcacc agggcagagg ctacagatcc 421 agaaccccct gtatccggtg accgagagct cctacagtgc ctatgccatc atgcttctgg 481 cgctggtggt gtttgcggtg ggcattgtgg gcaacctgtc ggtcatgtgc atcgtgtggc 541 acagctacta cctgaagagt gcctggaact ccatccttgc cagcctggcc ctctgggatt 601 ttctggtcct ctttttctgc ctccctattg tcatcttcaa cgagatcacc aagcagaggc 661 tactgggtga cgtttcttgt cgtgccgtgc ccttcatgga ggtctcctct ctgggagtca 721 cgactttcag cctctgtgcc ctgggcattg accgcttcca cgtggccacc agcaccctgc 781 ccaaggtgag gcccatcgag cggtgccaat ccatcctggc caagttggct gtcatctggg 841 tgggctccat gacgctggct gtgcctgagc tcctgctgtg gcagctggca caggagcctg 901 cccccaccat gggcaccctg gactcatgca tcatgaaacc ctcagccagc ctgcccgagt 961 ccctgtattc actggtgatg acctaccaga acgcccgcat gtggtggtac tttggctgct 1021 acttctgcct gcccatcctc ttcacagtca cctgccagct ggtgacatgg cgggtgcgag 1081 gccctccagg gaggaagtca gagtgcaggg ccagcaagca cgagcagtgt gagagccagc 1141 tcaacagcac cgtggtgggc ctgaccgtgg tctacgcctt ctgcaccctc ccagagaacg 1201 tctgcaacat cgtggtggcc tacctctcca ccgagctgac ccgccagacc ctggacctcc 1261 tgggcctcat caaccagttc tccaccTTCT TCAAGGGCGC CATCACCCCA GTGCTGCTCC 1321 TTTGCATCTG CAGGCCGCTG GGCCAGGCCT TCCTGGACTG CTGCTGCTGC TGCTGCTGTG 1381 AGGAGTGCGG CGGGGCTTCG GAGGCCTCTG CTGCCAATGG GTCGGACAAC AAGCTCAAGA 1441 CCGAGGTGTC CTCTTCCATC TACTTCCACA AGCCCAGGGA GTCACCCCCA CTCCTGCCCC 1501 TGGGCACACC TTGCTAGAAC CCAGCTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1561 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1621 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGACCACTAC GGAGTACTTA 1681 ACCTGAGACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt