Transcript: Mouse NM_134438.3

Mus musculus G protein-coupled receptor 37-like 1 (Gpr37l1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Gpr37l1 (171469)
Length:
2267
CDS:
178..1623

Additional Resources:

NCBI RefSeq record:
NM_134438.3
NBCI Gene record:
Gpr37l1 (171469)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_134438.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026079 CCCTGAGAACGTCTGCAATAT pLKO.1 1296 CDS 100% 13.200 9.240 N Gpr37l1 n/a
2 TRCN0000026139 CAATCAATTCTGGCTAAACTA pLKO.1 913 CDS 100% 5.625 3.938 N Gpr37l1 n/a
3 TRCN0000026056 CTCCCAATTGTCATCTTCAAT pLKO.1 727 CDS 100% 5.625 3.938 N Gpr37l1 n/a
4 TRCN0000026136 CGTTGGCAATCTGTCTGTCAT pLKO.1 612 CDS 100% 4.950 3.465 N Gpr37l1 n/a
5 TRCN0000026114 CTGTGGTCTATGCCTTCTGTA pLKO.1 1271 CDS 100% 4.950 3.465 N Gpr37l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134438.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487718 CCACTACGGAGTACTTAACCTGAG pLX_317 16.4% 86% 90.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489369 ACCGATACATCTTAGATTCTACAA pLX_317 16.2% 86% 90.4% V5 (many diffs) n/a
Download CSV