Construct: ORF TRCN0000487750
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020492.1_s317c1
- DNA Barcode:
- GACAGTGGCTCCGCGAAATTAGCA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- STK38L (23012)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487750
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 23012 | STK38L | serine/threonine kinase 38 ... | NM_015000.4 | 99.9% | 100% | 993G>A |
2 | human | 23012 | STK38L | serine/threonine kinase 38 ... | XM_006719058.4 | 99.9% | 100% | 993G>A |
3 | human | 23012 | STK38L | serine/threonine kinase 38 ... | XM_024448894.1 | 99.9% | 100% | 993G>A |
4 | human | 23012 | STK38L | serine/threonine kinase 38 ... | XM_024448895.1 | 99.9% | 100% | 993G>A |
5 | human | 23012 | STK38L | serine/threonine kinase 38 ... | XM_024448896.1 | 99.9% | 100% | 993G>A |
6 | human | 23012 | STK38L | serine/threonine kinase 38 ... | XM_024448897.1 | 99.9% | 100% | 993G>A |
7 | human | 23012 | STK38L | serine/threonine kinase 38 ... | XM_005253342.4 | 91% | 91.1% | 182_183ins123;870G>A |
8 | human | 23012 | STK38L | serine/threonine kinase 38 ... | XM_024448889.1 | 88.9% | 88.8% | 776_946del;1164G>A |
9 | human | 23012 | STK38L | serine/threonine kinase 38 ... | XM_024448890.1 | 88.9% | 88.8% | 776_946del;1164G>A |
10 | human | 23012 | STK38L | serine/threonine kinase 38 ... | XM_024448891.1 | 88.9% | 88.8% | 776_946del;1164G>A |
11 | human | 23012 | STK38L | serine/threonine kinase 38 ... | XM_024448892.1 | 88.9% | 88.8% | 776_946del;1164G>A |
12 | human | 23012 | STK38L | serine/threonine kinase 38 ... | XM_024448893.1 | 88.9% | 88.8% | 776_946del;1164G>A |
13 | human | 23012 | STK38L | serine/threonine kinase 38 ... | XM_006719059.3 | 88.7% | 88.7% | 0_1ins156;837G>A |
14 | human | 23012 | STK38L | serine/threonine kinase 38 ... | XM_011520613.2 | 79.8% | 79.9% | 0_1ins156;26_27ins123;714G>A |
15 | human | 23012 | STK38L | serine/threonine kinase 38 ... | XR_001748626.1 | 27.1% | (many diffs) | |
16 | mouse | 232533 | Stk38l | serine/threonine kinase 38 ... | NM_172734.3 | 89.8% | 97.6% | (many diffs) |
17 | mouse | 232533 | Stk38l | serine/threonine kinase 38 ... | XM_006507027.2 | 88.4% | 96.1% | (many diffs) |
18 | mouse | 232533 | Stk38l | serine/threonine kinase 38 ... | XM_006507029.3 | 87.3% | 94.9% | (many diffs) |
19 | mouse | 232533 | Stk38l | serine/threonine kinase 38 ... | XM_006507031.2 | 78% | 85.3% | (many diffs) |
20 | mouse | 232533 | Stk38l | serine/threonine kinase 38 ... | NM_001346666.1 | 66.6% | 72.6% | (many diffs) |
21 | mouse | 232533 | Stk38l | serine/threonine kinase 38 ... | XM_017321560.1 | 66.6% | 72.6% | (many diffs) |
22 | mouse | 232533 | Stk38l | serine/threonine kinase 38 ... | XM_006507032.2 | 65.6% | 71.5% | (many diffs) |
23 | mouse | 232533 | Stk38l | serine/threonine kinase 38 ... | XM_006507033.2 | 65.6% | 71.5% | (many diffs) |
24 | mouse | 232533 | Stk38l | serine/threonine kinase 38 ... | XR_001785124.1 | 18.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1464
- ORF length:
- 1392
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggcaatg acggcaggga ctacaacaac ctttcctatg agcaaccata 121 cccgggaaag agtgactgta gccaagctca cattggagaa tttttatagc aacctaattt 181 tacagcatga agagagagaa accaggcaga agaaattaga agtggccatg gaagaagaag 241 gattagcaga tgaagagaaa aagttacgtc gatcacaaca cgctcgcaaa gaaacagagt 301 tcttacggct caaaaggacc agacttggct tggatgactt tgagtctctg aaagttatag 361 gaagaggagc ttttggagag gtgcggttgg tccagaagaa agatacaggc catatctatg 421 caatgaagat attgagaaag tctgatatgc ttgaaaaaga gcaggtggcc catatccgag 481 cagaaagaga tattttggta gaagcagatg gtgcctgggt ggtgaagatg ttttacagtt 541 ttcaggataa gaggaatctt tatctaatca tggaatttct ccctggaggt gacatgatga 601 cattgctaat gaagaaagac accttgacag aagaggaaac acagttctac atttcagaga 661 ctgttctggc aatagatgcg atccaccagt tgggtttcat ccatcgggat attaagccag 721 acaacctttt attggatgcc aagggtcatg taaaattatc tgattttggt ttatgtacgg 781 gattaaagaa agctcacagg actgaatttt atagaaatct cacacacaac ccaccaagtg 841 acttctcatt tcagaacatg aactcaaaga ggaaagcaga aacttggaag aagaacagga 901 gacaactggc atattccaca gttgggacac cagattacat tgctccagaa gtattcatgc 961 agactggtta caacaaattg tgtgactggt ggtctttggg agtgattatg tatgaaatgc 1021 taataggata tccacctttc tgctctgaaa cacctcaaga aacatacaga aaagtgatga 1081 actggaaaga aactctggta tttcctccag aggtacctat atctgagaaa gccaaggact 1141 taattctcag attttgtatt gattctgaaa acagaattgg aaatagtgga gtagaagaaa 1201 taaaaggtca tccctttttt gaaggtgtcg actgggagca cataagggaa aggccagcag 1261 caaTCCCTAT AGAAATCAAA AGCATTGATG ATACTTCAAA TTTTGATGAC TTCCCTGAAT 1321 CTGATATTTT ACAACCAGTG CCAAATACCA CAGAACCGGA CTACAAATCC AAAGACTGGG 1381 TTTTTCTCAA TTATACCTAT AAAAGGTTTG AAGGGTTGAC TCAACGTGGC TCTATCCCCA 1441 CCTACATGAA AGCTGGGAAG TTATAGGACC CAGCTTTCTT GTACAAAGTG GTTGATATCG 1501 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1561 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAGACAGTGG 1621 CTCCGCGAAA TTAGCAACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1681 aagatt