Construct: ORF TRCN0000487769
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021466.1_s317c1
- DNA Barcode:
- TCATTACCAATCCATACTTAACCC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- SLC6A2 (6530)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487769
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6530 | SLC6A2 | solute carrier family 6 mem... | NM_001043.3 | 99.4% | 68.7% | 955T>C;1273G>T;1851_1852insTGAAAGCT |
| 2 | human | 6530 | SLC6A2 | solute carrier family 6 mem... | NM_001172501.2 | 99.4% | 68.7% | 955T>C;1273G>T;1851_1852insTGAAAGCT |
| 3 | human | 6530 | SLC6A2 | solute carrier family 6 mem... | NM_001172504.1 | 97.3% | 67.5% | (many diffs) |
| 4 | human | 6530 | SLC6A2 | solute carrier family 6 mem... | XM_006721263.2 | 97.3% | 67.5% | (many diffs) |
| 5 | human | 6530 | SLC6A2 | solute carrier family 6 mem... | XM_011523295.2 | 97.3% | 67.5% | (many diffs) |
| 6 | human | 6530 | SLC6A2 | solute carrier family 6 mem... | XM_011523297.3 | 92.2% | 61.4% | (many diffs) |
| 7 | human | 6530 | SLC6A2 | solute carrier family 6 mem... | XM_011523296.2 | 90.2% | 60.3% | (many diffs) |
| 8 | human | 6530 | SLC6A2 | solute carrier family 6 mem... | NM_001172502.1 | 81.2% | 47.2% | (many diffs) |
| 9 | human | 6530 | SLC6A2 | solute carrier family 6 mem... | XM_011523298.2 | 63.6% | 88.6% | (many diffs) |
| 10 | human | 6530 | SLC6A2 | solute carrier family 6 mem... | XM_011523299.2 | 60.5% | 29.6% | (many diffs) |
| 11 | human | 6530 | SLC6A2 | solute carrier family 6 mem... | XM_011523300.2 | 60.5% | 29.6% | (many diffs) |
| 12 | human | 6530 | SLC6A2 | solute carrier family 6 mem... | XR_933403.3 | 29.2% | (many diffs) | |
| 13 | mouse | 20538 | Slc6a2 | solute carrier family 6 (ne... | NM_009209.3 | 86.2% | 65.1% | (many diffs) |
| 14 | mouse | 20538 | Slc6a2 | solute carrier family 6 (ne... | XM_006530794.3 | 72.1% | 54.4% | (many diffs) |
| 15 | mouse | 20538 | Slc6a2 | solute carrier family 6 (ne... | XM_006530793.3 | 72% | 54.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1338
- ORF length:
- 1272
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaagaat 61 tcaccatgct tctggcgcgg atgaacccgc aggtgcagcc cgagaacaac ggggcggaca 121 cgggtccaga gcagcccctt cgggcgcgca aaactgcgga gctgctggtg gtgaaggagc 181 gcaacggcgt ccagtgcctg ctggcgcccc gcgacggcga cgcgcagccc cgggagacct 241 ggggcaagaa gatcgacttc ctgctgtccg tagtcggctt cgcagtggac ctggccaacg 301 tgtggcgctt cccctacctc tgctacaaga acggcggcgg tgccttcttg atcccgtaca 361 cactgttcct tatcatcgcg gggatgcccc tgttctacat ggagctggct ctgggacagt 421 acaaccggga gggggctgcc accgtttgga aaatctgccc attcttcaaa ggcgttggct 481 atgctgtcat cctgatcgcc ctgtacgttg gcttctacta caacgtcatc atcgcctggt 541 cactctacta cctcttctcc tccttcaccc tcaacctgcc ctggaccgac tgtggccaca 601 cctggaacag ccccaactgt accgacccca agctcctcaa tggctccgtg cttggcaacc 661 acaccaagta ctccaagtac aagttcacgc cggcagccga gttttatgag cgtggtgtcc 721 tgcaccttca cgagagcagc gggattcatg acatcggcct gccccagtgg cagctcttgc 781 tctgtctgat ggtcgtcgtc atcgtcttgt attttagcct ctggaaaggg gtgaagacat 841 caggaaaggt ggtgtggatc acagccacgc tgccttactt cgtgctgttc gtgctcctgg 901 tccatggcgt cacgctgccc ggagcctcca atggcatcaa tgcctacctg cacatcgact 961 tctaccgctt gaaagaggcc acggtatgga ttgatgccgc aactcagata tttttttccc 1021 tgggggctgg atttggagta ttgattgcat ttgccagtta caacaaattt gacaacaact 1081 gttacaggga tgccctgctg accagcagca tcaactgtat caccagcttc gtctctgggt 1141 tcgccatctt ctccatcctt ggttacatgg cccatgaaca caaggtcaac attgaggatg 1201 tggccacaga aggagctggc ctagtgttca tcctgtatcc agaggccatt tctaccctgt 1261 ctggatctac attctgggct gttgtgtttt tcgtcatgct cctggcgctg ggccttgaca 1321 gctcaatggg aggcatgtag gctgtcatca cgggcctggc agatgacttc caggtcctga 1381 agcgacaccg gaaactcttc acatttggcg tcaccttcag cactttcctt ctcgccctgt 1441 tctgcataac caagggtgga atttacgtct tgaccctcct ggacaccttt gctgcgggca 1501 cctccatcct ttttgctgtc ctcatggaag ccatcggagt ttcctggttt tatggagtgg 1561 acaggttcag caacgacatc cagcagatga tggggttcag gccgggtcta tactggagac 1621 tgtgctggaa gttcgtcagt cctgccttcc tcctgttcgt ggttgtggtc agcatcatca 1681 acttcaagcc actcaccTAC GACGACTACA TCTTCCCGCC CTGGGCCAAC TGGGTGGGGT 1741 GGGGCATCGC CCTGTCCTCC ATGGTCCTGG TGCCCATCTA CGTCATCTAT AAGTTCCTCA 1801 GCACGCAGGG CTCTCTTTGG GAGAGACTGG CCTATGGCAT CACGCCAGAG AACGAGCACC 1861 ACCTGGTGGC TCAGAGGGAC ATCAGACAGT TCCAGTTGCA ACACTGGCTG GCCATCTGAA 1921 AGCTTGACCC AGCTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1981 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 2041 CTTGGCTTTA TATATCTTGT GGAAAGGACG ATCATTACCA ATCCATACTT AACCCACGCG 2101 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt