Transcript: Mouse XM_006530793.3

PREDICTED: Mus musculus solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2 (Slc6a2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc6a2 (20538)
Length:
6269
CDS:
32..2251

Additional Resources:

NCBI RefSeq record:
XM_006530793.3
NBCI Gene record:
Slc6a2 (20538)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530793.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079311 GCGGTGCTTATGGAAGCTATT pLKO.1 1847 CDS 100% 10.800 15.120 N Slc6a2 n/a
2 TRCN0000079310 GCCCATGAACATAAGGTCAAT pLKO.1 1502 CDS 100% 4.950 3.960 N Slc6a2 n/a
3 TRCN0000079312 CCATACCAAATACTCCAAATA pLKO.1 991 CDS 100% 13.200 9.240 N Slc6a2 n/a
4 TRCN0000079309 CCCATGAACATAAGGTCAATA pLKO.1 1503 CDS 100% 13.200 9.240 N Slc6a2 n/a
5 TRCN0000079308 GCTCGGCATTTAGAGTTGATT pLKO.1 5553 3UTR 100% 5.625 3.938 N Slc6a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530793.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489676 TTTTTCTTAGTGTTGTCACTCCAT pLX_317 21.6% 72.2% 54.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000487769 TCATTACCAATCCATACTTAACCC pLX_317 12.7% 72% 54.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV