Transcript: Human XM_011523300.2

PREDICTED: Homo sapiens solute carrier family 6 member 2 (SLC6A2), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC6A2 (6530)
Length:
6515
CDS:
1545..2675

Additional Resources:

NCBI RefSeq record:
XM_011523300.2
NBCI Gene record:
SLC6A2 (6530)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523300.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432670 TAGGTTCATGAGGTCGGAAAT pLKO_005 2967 3UTR 100% 10.800 15.120 N SLC6A2 n/a
2 TRCN0000043573 GCTGGATTTGGAGTATTGATT pLKO.1 1782 CDS 100% 5.625 4.500 N SLC6A2 n/a
3 TRCN0000043575 GCCCATCTACGTCATCTATAA pLKO.1 2528 CDS 100% 13.200 9.240 N SLC6A2 n/a
4 TRCN0000043577 CCACACCAAGTACTCCAAGTA pLKO.1 1415 5UTR 100% 4.950 3.465 N SLC6A2 n/a
5 TRCN0000043576 CCATGAACACAAGGTCAACAT pLKO.1 1928 CDS 100% 4.950 3.465 N SLC6A2 n/a
6 TRCN0000435137 ACCACATTTGCCTAGACTTTG pLKO_005 2992 3UTR 100% 10.800 6.480 N SLC6A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523300.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489676 TTTTTCTTAGTGTTGTCACTCCAT pLX_317 21.6% 60.7% 29.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000487769 TCATTACCAATCCATACTTAACCC pLX_317 12.7% 60.5% 29.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV