Construct: ORF TRCN0000487899
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021049.1_s317c1
- DNA Barcode:
- ACCAGCACTGGCACATTGAGCGCA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- TACR1 (6869)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487899
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6869 | TACR1 | tachykinin receptor 1 | NM_015727.3 | 99.8% | 100% | 333T>C |
| 2 | human | 6869 | TACR1 | tachykinin receptor 1 | NM_001058.4 | 76.3% | 76.4% | 333T>C;934_1221del |
| 3 | mouse | 21336 | Tacr1 | tachykinin receptor 1 | NM_009313.5 | 69.4% | 73.2% | (many diffs) |
| 4 | mouse | 21336 | Tacr1 | tachykinin receptor 1 | XM_006505863.3 | 69.4% | 73.2% | (many diffs) |
| 5 | mouse | 21336 | Tacr1 | tachykinin receptor 1 | XM_006505864.3 | 69.4% | 73.2% | (many diffs) |
| 6 | mouse | 21336 | Tacr1 | tachykinin receptor 1 | XM_006505865.3 | 69.4% | 73.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1005
- ORF length:
- 933
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggataac gtcctcccgg tggactcaga cctctcccca aacatctcca 121 ctaacacctc ggaacccaat cagttcgtgc aaccagcctg gcaaattgtc ctttgggcag 181 ctgcctacac ggtcattgtg gtgacctctg tggtgggcaa cgtggtagtg atgtggatca 241 tcttagccca caaaagaatg aggacagtga cgaactattt tctggtgaac ctggccttcg 301 cggaggcctc catggctgca ttcaatacag tggtgaactt cacctatgct gtccacaacg 361 aatggtacta cggcctgttc tactgcaagt tccacaactt cttccccatc gccgctgtct 421 tcgccagtat ctactccatg acggctgtgg cctttgatag gtacatggcc atcatacatc 481 ccctccagcc ccggctgtca gccacagcca ccaaagtggt catctgtgtc atctgggtcc 541 tggctctcct gctggccttc ccccagggct actactcaac cacagagacc atgcccagca 601 gagtcgtgtg catgatcgaa tggccagagc atccgaacaa gatttatgag aaagtgtacc 661 acatctgtgt gactgtgctg atctacttcc tccccctgct ggtgattggc tatgcataca 721 ccgtagtggg aatcacacta tgggccagtg agaTCCCCGG GGACTCCTCT GACCGCTACC 781 ACGAGCAAGT CTCTGCCAAG CGCAAGGTGG TCAAAATGAT GATTGTCGTG GTGTGCACCT 841 TCGCCATCTG CTGGCTGCCC TTCCACATCT TCTTCCTCCT GCCCTACATC AACCCAGATC 901 TCTACCTGAA GAAGTTTATC CAGCAGGTCT ACCTGGCCAT CATGTGGCTG GCCATGAGCT 961 CCACCATGTA CAACCCCATC ATCTACTGCT GCCTCAATGA CAGGTAGAAC CCAGCTTTCT 1021 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1081 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1141 GTGGAAAGGA CGAACCAGCA CTGGCACATT GAGCGCAACG CGTTAAGTCg acaatcaacc 1201 tctggattac aaaatttgtg aaagatt