Construct: ORF TRCN0000487917
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021719.1_s317c1
- DNA Barcode:
- TTCGCGCTATCTACGTCATTTCTA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- INSR (3643)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487917
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3643 | INSR | insulin receptor | XM_011527989.3 | 27.6% | 1% | 1_2971del |
| 2 | human | 3643 | INSR | insulin receptor | NM_001079817.3 | 27.6% | 1% | 1_2974del |
| 3 | human | 3643 | INSR | insulin receptor | XM_011527988.2 | 27.4% | 1% | 1_3007del |
| 4 | human | 3643 | INSR | insulin receptor | NM_000208.4 | 27.3% | 1% | 1_3010del |
| 5 | mouse | 16337 | Insr | insulin receptor | XM_006508701.1 | 24.4% | 1% | (many diffs) |
| 6 | mouse | 16337 | Insr | insulin receptor | NM_010568.3 | 24.4% | 1% | (many diffs) |
| 7 | mouse | 16337 | Insr | insulin receptor | XM_006508700.1 | 24.2% | 1% | (many diffs) |
| 8 | mouse | 16337 | Insr | insulin receptor | NM_001330056.1 | 24.2% | 1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 85
- ORF end:
- 241
- ORF length:
- 156
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaatcaa 61 accctgagta tctcagtgcc agtgatgtgt ttccatgctc tgtgtacgtg ccggacgagt 121 gggaggtgtc tcgagagaag atcaccctcc ttcgagagct ggggcagggc tccttcggca 181 tggtgtatga gggcaatgcc agggacatca tcaagggtga ggcagagacc cgcgtggcgg 241 tgaagacggt caacgagtca gccagtctcc gagagcggat tgagttcctc aatgaggcct 301 cggtcatgaa gggcttcacc tgccatcacg tggtgcgcct cctgggagtg gtgtccaagg 361 gccagcccac gctggtggtg atggagctga tggctcacgg agacctgaag agctacctcc 421 gttctctgcg gccagaggct gagaataatc ctggccgccc tccccctacc cttcaagaga 481 tgattcagat ggcggcagag attgctgacg ggatggccta cctgaacgcc aagaagtttg 541 tgcatcggga cctggcagcg agaaactgca tggtcgccca tgattttact gtcaaaattg 601 gagactttgg aatgaccaga gacatctatg aaacggatta ctaccggaaa gggggcaagg 661 gtctgctccc tgtacggtgg atggcaccgg agtccctgaa ggatggggtc ttcaccactt 721 cttctgacat gtggtccttt ggcgtggtcc tttgggaaat caccagcttg gcagaacagc 781 cttaccaagg cctgtctaat gaacaggtgt tgaaatttgt catggatgga gggtatctgg 841 atcaacccga caactgtcca gagagagtca ctgacctcat gcgcatgtgc tggcaattca 901 accccaagat gaggccaaCC TTCCTGGAGA TTGTCAACCT GCTCAAGGAC GACCTGCACC 961 CCAGCTTTCC AGAGGTGTCG TTCTTCCACA GCGAGGAGAA CAAGGCTCCC GAGAGTGAGG 1021 AGCTGGAGAT GGAGTTTGAG GACATGGAGA ATGTGCCCCT GGACCGTTCC TCGCACTGTC 1081 AGAGGGAGGA GGCGGGGGGC CGGGATGGAG GGTCCTCGCT GGGTTTCAAG CGGAGCTACG 1141 AGGAACACAT CCCTTACACA CACATGAACG GAGGCAAGAA AAACGGGCGG ATTCTGACCT 1201 TGCCTCGGTC CAATCCTTCC TAAGACCCAG CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1261 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1321 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAT TCGCGCTATC 1381 TACGTCATTT CTAACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1441 att