Construct: ORF TRCN0000487940
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019517.1_s317c1
- DNA Barcode:
- ATCCTTGTCAGTATTAGCAAACAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GPR63 (81491)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487940
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 81491 | GPR63 | G protein-coupled receptor 63 | NM_001143957.3 | 99.9% | 99.7% | 1257_1258insG |
| 2 | human | 81491 | GPR63 | G protein-coupled receptor 63 | NM_030784.4 | 99.9% | 99.7% | 1257_1258insG |
| 3 | human | 81491 | GPR63 | G protein-coupled receptor 63 | XM_006715570.4 | 99.9% | 99.7% | 1257_1258insG |
| 4 | human | 81491 | GPR63 | G protein-coupled receptor 63 | XM_011536153.2 | 99.9% | 99.7% | 1257_1258insG |
| 5 | human | 81491 | GPR63 | G protein-coupled receptor 63 | XM_011536154.2 | 99.9% | 99.7% | 1257_1258insG |
| 6 | human | 81491 | GPR63 | G protein-coupled receptor 63 | XM_011536155.2 | 99.9% | 99.7% | 1257_1258insG |
| 7 | human | 81491 | GPR63 | G protein-coupled receptor 63 | XM_011536157.2 | 99.9% | 99.7% | 1257_1258insG |
| 8 | human | 81491 | GPR63 | G protein-coupled receptor 63 | XM_011536159.2 | 99.9% | 99.7% | 1257_1258insG |
| 9 | human | 81491 | GPR63 | G protein-coupled receptor 63 | XM_017011334.1 | 99.9% | 99.7% | 1257_1258insG |
| 10 | mouse | 81006 | Gpr63 | G protein-coupled receptor 63 | NM_030733.3 | 86.2% | 90.8% | (many diffs) |
| 11 | mouse | 81006 | Gpr63 | G protein-coupled receptor 63 | XM_006538382.3 | 86.2% | 90.8% | (many diffs) |
| 12 | mouse | 81006 | Gpr63 | G protein-coupled receptor 63 | XM_006538383.3 | 86.2% | 90.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1335
- ORF length:
- 1260
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatggtc ttctcggcag tgttgactgc gttccatacc gggacatcca 121 acacaacatt tgtcgtgtat gaaaacacct acatgaatat tacactccct ccaccattcc 181 agcatcctga cctcagtcca ttgcttagat atagttttga aaccatggct cccactggtt 241 tgagttcctt gaccgtgaat agtacagctg tgcccacaac accagcagca tttaagagcc 301 taaacttgcc tcttcagatc accctttctg ctataatgat attcattctg tttgtgtctt 361 ttcttgggaa cttggttgtt tgcctcatgg tttaccaaaa agctgccatg aggtctgcaa 421 ttaacatcct ccttgccagc ctagcttttg cagacatgtt gcttgcagtg ctgaacatgc 481 cctttgccct ggtaactatt cttactaccc gatggatttt tgggaaattc ttctgtaggg 541 tatctgctat gtttttctgg ttatttgtga tagaaggagt agccatcctg ctcatcatta 601 gcatagatag gttccttatt atagtccaga ggcaggataa gctaaaccca tatagagcta 661 aggttctgat tgcagtttct tgggcaactt ccttttgtgt agcttttcct ttagccgtag 721 gaaaccccga cctgcagata ccttcccgag ctccccagtg tgtgtttggg tacacaacca 781 atccaggcta ccaggcttat gtgattttga tttctctcat ttctttcttc atacccttcc 841 tggtaatact gtactcattt atgggcatac tcaacaccct tcggcacaat gccttgagga 901 tccatagcta ccctgaaggt atatgcctca gccaggccag caaactgggt ctcatgagtc 961 tgcagagacc tttccagatg agcattgaca tgggctttaa aacacgtgCC TTCACCACTA 1021 TTTTGATTCT CTTTGCTGTC TTCATTGTCT GCTGGGCCCC ATTCACCACT TACAGCCTTG 1081 TGGCAACATT CAGTAAGCAC TTTTACTATC AGCACAACTT TTTTGAGATT AGCACCTGGC 1141 TACTGTGGCT CTGCTACCTC AAGTCTGCAT TGAATCCGCT GATCTACTAC TGGAGGATTA 1201 AGAAATTCCA TGATGCTTGC CTGGACATGA TGCCTAAGTC CTTCAAGTTT TTGCCGCAGC 1261 TCCCTGGTCA CACAAAGCGA CGGATACGTC CTAGTGCTGT CTATGTGTGT GGGGAACATC 1321 GGACGGTGGT GGACCCAGCT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1381 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1441 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGAATC CTTGTCAGTA TTAGCAAACA 1501 CACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t