Construct: ORF TRCN0000488177
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020857.1_s317c1
- DNA Barcode:
- AACCGTGTTCTCCGCTCTGCTAGG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- AGTR1 (185)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488177
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 185 | AGTR1 | angiotensin II receptor type 1 | NM_000685.4 | 99.7% | 99.4% | 573C>T;664C>G;1022C>A |
| 2 | human | 185 | AGTR1 | angiotensin II receptor type 1 | NM_009585.3 | 99.7% | 99.4% | 573C>T;664C>G;1022C>A |
| 3 | human | 185 | AGTR1 | angiotensin II receptor type 1 | NM_032049.3 | 92.2% | 92% | (many diffs) |
| 4 | human | 185 | AGTR1 | angiotensin II receptor type 1 | NM_004835.4 | 90.8% | 90.6% | (many diffs) |
| 5 | human | 185 | AGTR1 | angiotensin II receptor type 1 | NM_031850.3 | 90.8% | 90.6% | (many diffs) |
| 6 | mouse | 11607 | Agtr1a | angiotensin II receptor, ty... | NM_177322.3 | 86.7% | 93.8% | (many diffs) |
| 7 | mouse | 11607 | Agtr1a | angiotensin II receptor, ty... | XM_006516534.1 | 86.7% | 93.8% | (many diffs) |
| 8 | mouse | 11607 | Agtr1a | angiotensin II receptor, ty... | XM_011244264.2 | 86.7% | 93.8% | (many diffs) |
| 9 | mouse | 11608 | Agtr1b | angiotensin II receptor, ty... | NM_175086.3 | 85.4% | 92.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1149
- ORF length:
- 1077
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgattctc aactcttcta ctgaagatgg tattaaaaga atccaagatg 121 attgtcccaa agctggaagg cataattaca tatttgtcat gattcctact ttatacagta 181 tcatctttgt ggtgggaata tttggaaaca gcttggtggt gatagtcatt tacttttata 241 tgaagctgaa gactgtggcc agtgtttttc ttttgaattt agcactggct gacttatgct 301 ttttactgac tttgccacta tgggctgtct acacagctat ggaataccgc tggccctttg 361 gcaattacct atgtaagatt gcttcagcca gcgtcagttt caacctgtac gctagtgtgt 421 ttctactcac gtgtctcagc attgatcgat acctggctat tgttcaccca atgaagtccc 481 gccttcgacg cacaatgctt gtagccaaag tcacctgcat catcatttgg ctgctggcag 541 gcttggccag tttgccagct ataatccatc gaaatgtatt tttcattgag aacaccaata 601 ttacagtttg tgctttccat tatgagtccc aaaattcaac ccttccgata gggctgggcc 661 tgaccaaaaa tatactgggt ttcctgtttc cttttctgat cattcttaca agttatactc 721 ttatttggaa ggccgtaaag aaggcttatg aaattcagaa gaacaaacca agaaatgatg 781 atatttttaa gataattatg gcaattgtgc ttttcttttt cttttcctgg attccccacc 841 aaatattcac ttttctggat gtattgattc aactaggcat catacgtgac tgtagaattg 901 cagatattgt ggacacggcc atgcctatca ccatttgtat agcttatttt aacaattgcc 961 tgaatCCTCT TTTTTATGGC TTTCTGGGGA AAAAATTTAA AAGATATTTT CTCCAGCTTC 1021 TAAAATATAT TCCCCCAAAA GCCAAATCCC ACTCAAACCT TTCAACAAAA ATGAGCACGC 1081 TTTCCTACCG CCACTCAGAT AATGTAAGCT CATCCACCAA GAAGCCTGCA CCATGTTTTG 1141 AGGTTGAGTA GGACCCAGCT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1201 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1261 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGAAAC CGTGTTCTCC GCTCTGCTAG 1321 GACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t