Construct: ORF TRCN0000488198
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020625.1_s317c1
- DNA Barcode:
- CCAACTGCGATGAGGTACCACCGT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- PTK6 (5753)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488198
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 5753 | PTK6 | protein tyrosine kinase 6 | NM_005975.4 | 100% | 100% | |
2 | human | 5753 | PTK6 | protein tyrosine kinase 6 | XM_017027982.1 | 60.3% | 49.4% | 668_669insAGACAACCTCCTGCACCAGC;816_817ins517 |
3 | human | 5753 | PTK6 | protein tyrosine kinase 6 | NM_001256358.1 | 29.7% | 21.3% | 230_231ins122;402_403ins829 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1425
- ORF length:
- 1353
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggtgtcc cgggaccagg ctcacctggg ccccaagtat gtgggcctct 121 gggacttcaa gtcccggacg gacgaggagc tgagcttccg cgcgggggac gtcttccacg 181 tggccaggaa ggaggagcag tggtggtggg ccacgctgct ggacgaggcg ggtggggccg 241 tggcccaggg ctatgtgccc cacaactacc tggccgagag ggagacggtg gagtcggaac 301 cgtggttctt tggctgcatc tcccgctcgg aagctgtgcg tcggctgcag gccgagggca 361 acgccacggg cgccttcctg atcagggtca gcgagaagcc gagtgccgac tacgtcctgt 421 cggtgcggga cacgcaggct gtgcggcact acaagatctg gcggcgtgcc gggggccggc 481 tgcacctgaa cgaggcggtg tccttcctca gcctgcccga gcttgtgaac taccacaggg 541 cccagagcct gtcccacggc ctgcggctgg ccgcgccctg ccggaagcac gagcctgagc 601 ccctgcccca ttgggatgac tgggagaggc cgagggagga gttcacgctc tgcaggaagc 661 tggggtccgg ctactttggg gaggtcttcg aggggctctg gaaagaccgg gtccaggtgg 721 ccattaaggt gatttctcga gacaacctcc tgcaccagca gatgctgcag tcggagatcc 781 aggccatgaa gaagctgcgg cacaaacaca tcctggcgct gtacgccgtg gtgtccgtgg 841 gggaccccgt gtacatcatc acggagctca tggccaaggg cagcctgctg gagctgctcc 901 gcgactctga tgagaaagtc ctgcccgttt cggagctgct ggacatcgcc tggcaggtgg 961 ctgagggcat gtgttacctg gagtcgcaga attacatcca ccgggacctg gccgccagga 1021 acatcctcgt cggggaaaac accctctgca aagttgggga cttcgggtta gccaggctta 1081 tcaaggagga cgtctacctc tcccatgacc acaatatccc ctacaagtgg acggcccctg 1141 aagcgctctc ccgaggccat tactccacca aaTCCGACGT CTGGTCCTTT GGGATTCTCC 1201 TGCATGAGAT GTTCAGCAGG GGTCAGGTGC CCTACCCAGG CATGTCCAAC CATGAGGCCT 1261 TCCTGAGGGT GGACGCCGGC TACCGCATGC CCTGCCCTCT GGAGTGCCCG CCCAGCGTGC 1321 ACAAGCTGAT GCTGACATGC TGGTGCAGGG ACCCCGAGCA GAGACCCTGC TTCAAGGCCC 1381 TGCGGGAGAG GCTCTCCAGC TTCACCAGCT ACGAGAACCC GACCTAGAAC CCAGCTTTCT 1441 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1501 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1561 GTGGAAAGGA CGACCAACTG CGATGAGGTA CCACCGTACG CGTTAAGTCg acaatcaacc 1621 tctggattac aaaatttgtg aaagatt