Transcript: Human XM_017027982.1

PREDICTED: Homo sapiens protein tyrosine kinase 6 (PTK6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTK6 (5753)
Length:
957
CDS:
57..875

Additional Resources:

NCBI RefSeq record:
XM_017027982.1
NBCI Gene record:
PTK6 (5753)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027982.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199336 CGGGTCCAGGTGGCCATTAAG pLKO.1 693 CDS 100% 0.000 0.000 N PTK6 n/a
2 TRCN0000314824 AGGTGGCCATTAAGGTGATTT pLKO_005 700 CDS 100% 13.200 9.240 N PTK6 n/a
3 TRCN0000314825 AGTCGGAACCGTGGTTCTTTG pLKO_005 277 CDS 100% 10.800 7.560 N PTK6 n/a
4 TRCN0000381105 TCCGCGACTCTGATGAGAAAG pLKO_005 863 CDS 100% 10.800 7.560 N PTK6 n/a
5 TRCN0000021550 GCCATTAAGGTGATTTCTCGA pLKO.1 705 CDS 100% 2.640 1.848 N PTK6 n/a
6 TRCN0000199853 GCTCCGCGACTCTGATGAGAA pLKO.1 861 CDS 100% 1.650 1.155 N PTK6 n/a
7 TRCN0000199057 CCGTGGTTCTTTGGCTGCATC pLKO.1 285 CDS 100% 1.350 0.945 N PTK6 n/a
8 TRCN0000350386 TTACCTGGAGTCGCAGAATTA pLKO_005 939 3UTR 100% 13.200 9.240 N PTK6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027982.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14819 pDONR223 0% 60.3% 49.4% None 668_669insAGACAACCTCCTGCACCAGC;816_817ins517 n/a
2 ccsbBroad304_14819 pLX_304 0% 60.3% 49.4% V5 668_669insAGACAACCTCCTGCACCAGC;816_817ins517 n/a
3 TRCN0000480339 CTGATGCGCCTTTGCCGGGGGAGG pLX_317 28.9% 60.3% 49.4% V5 668_669insAGACAACCTCCTGCACCAGC;816_817ins517 n/a
4 TRCN0000488198 CCAACTGCGATGAGGTACCACCGT pLX_317 19.2% 60.3% 49.4% V5 (not translated due to prior stop codon) 668_669insAGACAACCTCCTGCACCAGC;816_817ins517 n/a
Download CSV