Construct: ORF TRCN0000488213
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019404.1_s317c1
- DNA Barcode:
- GCCCTTTATAACTTGGCCGAAAGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NMUR1 (10316)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488213
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10316 | NMUR1 | neuromedin U receptor 1 | XM_011510487.3 | 99.8% | 99.5% | 539G>A;1209_1210insG |
| 2 | human | 10316 | NMUR1 | neuromedin U receptor 1 | NM_006056.5 | 94.4% | 94.1% | 1_69del;608G>A;1278_1279insG |
| 3 | human | 10316 | NMUR1 | neuromedin U receptor 1 | XM_006712195.3 | 74.2% | 67.2% | (many diffs) |
| 4 | human | 10316 | NMUR1 | neuromedin U receptor 1 | XM_011510488.2 | 72.2% | 65.5% | (many diffs) |
| 5 | human | 10316 | NMUR1 | neuromedin U receptor 1 | XM_006712196.3 | 68.5% | 64.9% | (many diffs) |
| 6 | human | 10316 | NMUR1 | neuromedin U receptor 1 | XM_011510489.2 | 67.3% | 65.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1287
- ORF length:
- 1212
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatggct tgcaatggca gtgcggccag ggggcacttt gaccctgagg 121 acttgaacct gactgacgag gcactgagac tcaagtacct ggggccccag cagacagagc 181 tgttcatgcc catctgtgcc acatacctgc tgatcttcgt ggtgggcgct gtgggcaatg 241 ggctgacctg tctggtcatc ctgcgccaca aggccatgcg cacgcctacc aactactacc 301 tcttcagcct ggccgtgtcg gacctgctgg tgctgctggt gggcctgccc ctggagctct 361 atgagatgtg gcacaactac cccttcctgc tgggcgttgg tggctgctat ttccgcacgc 421 tactgtttga gatggtctgc ctggcctcag tgctcaacgt cactgccctg agcgtggaac 481 gctatgtggc cgtggtgcac ccactccagg ccaggtccat ggtgacgcgg gcccatgtgc 541 gccgagtgct tggggccgtc tggggtcttg ccatgctctg ctccctgccc aacaccagcc 601 tgcacggcat ccagcagctg cacgtgccct gccggggccc agtgccagac tcagctgttt 661 gcatgctggt ccgcccacgg gccctctaca acatggtagt gcagaccacc gcgctgctct 721 tcttctgcct gcccatggcc atcatgagcg tgctctacct gctcattggg ctgcgactgc 781 ggcgggagag gctgctgctc atgcaggagg ccaagggcag gggctctgca gcagccaggt 841 ccagatacac ctgcaggctc cagcagcacg atcggggccg gagacaagtg accaagatgc 901 tgtttgtcct ggtcgtggtg tttggcatct gctgggcccc gttccacgcc gaccgcgtca 961 tgtggagcgt cgtgtcacag tggacagatg gcctgcacct ggccTTCCAG CACGTGCACG 1021 TCATCTCCGG CATCTTCTTC TACCTGGGCT CGGCGGCCAA CCCCGTGCTC TATAGCCTCA 1081 TGTCCAGCCG CTTCCGAGAG ACCTTCCAGG AGGCCCTGTG CCTCGGGGCC TGCTGCCATC 1141 GCCTCAGACC CCGCCACAGC TCCCACAGCC TCAGCAGGAT GACCACAGGC AGCACCCTGT 1201 GTGATGTGGG CTCCCTGGGC AGCTGGGTCC ACCCCCTGGC TGGGAACGAT GGCCCAGAGG 1261 CGCAGCAAGA GACCGATCCA TCCGACCCAG CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1321 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1381 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAG CCCTTTATAA 1441 CTTGGCCGAA AGTACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1501 att