Construct: ORF TRCN0000488240
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021296.1_s317c1
- DNA Barcode:
- GTGGAGTTATAACGGGCCCATCCC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- CELA2A (63036)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488240
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 63036 | CELA2A | chymotrypsin like elastase 2A | NM_033440.3 | 100% | 100% | |
| 2 | human | 51032 | CELA2B | chymotrypsin like elastase 2B | NM_015849.3 | 93% | 88.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 879
- ORF length:
- 807
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgataagg acgctgctgc tgtccacttt ggtggctgga gccctcagtt 121 gtggggaccc cacttaccca ccttatgtga ctagggtggt tggcggtgaa gaagcgaggc 181 ccaacagctg gccctggcag gtctccctgc agtacagctc caatggcaag tggtaccaca 241 cctgcggagg gtccctgata gccaacagct gggtcctgac ggctgcccac tgcatcagct 301 cctccaggac ctaccgcgtg gggctgggcc ggcacaacct ctacgttgcg gagtccggct 361 cgctggcagt cagtgtctct aagattgtgg tgcacaagga ctggaactcc aaccaaatct 421 ccaaagggaa cgacattgcc ctgctcaaac tggctaaccc cgtctccctc accgacaaga 481 tccagctggc ctgcctccct cctgccggca ccattctacc caacaactac ccctgctacg 541 tcacgggctg gggaaggctg cagaccaacg gggctgttcc tgatgtcctg cagcagggcc 601 ggttgctggt tgtggactat gccacctgct ccagctctgc ctggtggGGC AGCAGCGTGA 661 AAACCAGTAT GATCTGTGCT GGGGGTGATG GCGTGATCTC CAGCTGCAAC GGAGACTCTG 721 GCGGGCCACT GAACTGTCAG GCGTCTGACG GCCGGTGGCA GGTGCACGGC ATCGTCAGCT 781 TCGGGTCTCG CCTCGGCTGC AACTACTACC ACAAGCCCTC CGTCTTCACG CGGGTCTCCA 841 ATTACATCGA CTGGATCAAT TCGGTGATTG CAAATAACTA GAACCCAGCT TTCTTGTACA 901 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 961 AATGAACTAG CCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1021 AGGACGAGTG GAGTTATAAC GGGCCCATCC CACGCGTTAA GTCgacaatc aacctctgga 1081 ttacaaaatt tgtgaaagat t