Construct: ORF TRCN0000488270
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021162.1_s317c1
- DNA Barcode:
- CGACAACACACAGATGAATAACCT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- GALR2 (8811)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488270
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8811 | GALR2 | galanin receptor 2 | NM_003857.4 | 100% | 100% | |
| 2 | human | 8811 | GALR2 | galanin receptor 2 | XM_011525427.3 | 79.5% | 74.3% | (many diffs) |
| 3 | mouse | 14428 | Galr2 | galanin receptor 2 | NM_010254.4 | 81.2% | 80.9% | (many diffs) |
| 4 | mouse | 14428 | Galr2 | galanin receptor 2 | XM_011248727.2 | 80.3% | 80.1% | (many diffs) |
| 5 | mouse | 14428 | Galr2 | galanin receptor 2 | XM_011248728.2 | 80.2% | 80.1% | (many diffs) |
| 6 | mouse | 14428 | Galr2 | galanin receptor 2 | XM_011248729.2 | 76.9% | 78.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1233
- ORF length:
- 1161
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgaacgtc tcgggctgcc caggggccgg gaacgcgagc caggcgggcg 121 gcgggggagg ctggcacccc gaggcggtca tcgtgcccct gctcttcgcg ctcatcttcc 181 tcgtgggcac cgtgggcaac acgctggtgc tggcggtgct gctgcgcggc ggccaggcgg 241 tcagcactac caacctgttc atccttaacc tgggcgtggc cgacctgtgt ttcatcctgt 301 gctgcgtgcc cttccaggcc accatctaca ccctggacgg ctgggtgttc ggctcgctgc 361 tgtgcaaggc ggtgcacttc ctcatcttcc tcaccatgca cgccagcagc ttcacgctgg 421 ccgccgtctc cctggacagg tatctggcca tccgctaccc gctgcactcc cgcgagctgc 481 gcacgcctcg aaacgcgctg gcagccatcg ggctcatctg ggggctgtcg ctgctcttct 541 ccgggcccta cctgagctac taccgccagt cgcagctggc caacctgacc gtgtgccatc 601 ccgcgtggag cgcccctcgc cgccgcgcca tggacatctg caccttcgtc ttcagctacc 661 tgcttcctgt gctggttctc ggcctgacct acgcgcgcac cttgcgctac ctctggcgcg 721 ccgtcgaccc ggtggccgcg ggctcgggtg cccggcgcgc caagcgcaag gtgacacgca 781 tgatcctcat cgtggccgcg ctcttctgcc tctgctggat gccccaccac gcgctcatcc 841 tctgcgtgtg gttcggccag ttcccgctca cgcgcgccac ttatgcgctt cgcatcctct 901 cgcacctggt ctcctacgcc aactccTGCG TCAACCCCAT CGTTTACGCG CTGGTCTCCA 961 AGCACTTCCG CAAAGGCTTC CGCACGATCT GCGCGGGCCT GCTGGGCCGT GCCCCAGGCC 1021 GAGCCTCGGG CCGTGTGTGC GCTGCCGCGC GGGGCACCCA CAGTGGCAGC GTGTTGGAGC 1081 GCGAGTCCAG CGACCTGTTG CACATGAGCG AGGCGGCGGG GGCCCTTCGT CCCTGCCCCG 1141 GCGCTTCCCA GCCATGCATC CTCGAGCCCT GTCCTGGCCC GTCCTGGCAG GGCCCAAAGG 1201 CAGGCGACAG CATCCTGACG GTTGATGTGG CCTGAGACCC AGCTTTCTTG TACAAAGTGG 1261 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1321 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1381 ACGACAACAC ACAGATGAAT AACCTACGCG TTAAGTCgac aatcaacctc tggattacaa 1441 aatttgtgaa agatt