Transcript: Human NM_003857.4

Homo sapiens galanin receptor 2 (GALR2), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
GALR2 (8811)
Length:
1373
CDS:
104..1267

Additional Resources:

NCBI RefSeq record:
NM_003857.4
NBCI Gene record:
GALR2 (8811)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003857.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008377 CGCCACTTATGCGCTTCGCAT pLKO.1 907 CDS 100% 0.880 1.232 N GALR2 n/a
2 TRCN0000357056 GGTCAGCACTACCAACCTGTT pLKO_005 271 CDS 100% 4.050 2.835 N GALR2 n/a
3 TRCN0000357081 GTCTCCAAGCACTTCCGCAAA pLKO_005 986 CDS 100% 4.050 2.835 N GALR2 n/a
4 TRCN0000008379 CCTGCTCTTCGCGCTCATCTT pLKO.1 190 CDS 100% 1.650 1.155 N GALR2 n/a
5 TRCN0000008378 GCGCAAGGTGACACGCATGAT pLKO.1 796 CDS 100% 1.650 1.155 N GALR2 n/a
6 TRCN0000008381 CCAGGCGGTCAGCACTACCAA pLKO.1 265 CDS 100% 0.000 0.000 N GALR2 n/a
7 TRCN0000008380 GCGCGAGTCCAGCGACCTGTT pLKO.1 1111 CDS 100% 0.000 0.000 N GALR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003857.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02020 pDONR223 100% 100% 100% None n/a
2 TRCN0000488646 CTCAATCCTGCACAAGAGCCAGTA pLX_317 26.6% 100% 100% V5 n/a
3 TRCN0000488270 CGACAACACACAGATGAATAACCT pLX_317 26.8% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV