Construct: ORF TRCN0000488276
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020985.1_s317c1
- DNA Barcode:
- CACTTCATGTCTTTCTTATAAGGT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- GPR141 (353345)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488276
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 353345 | GPR141 | G protein-coupled receptor 141 | NM_001329993.2 | 100% | 100% | |
| 2 | human | 353345 | GPR141 | G protein-coupled receptor 141 | NM_001329994.2 | 100% | 100% | |
| 3 | human | 353345 | GPR141 | G protein-coupled receptor 141 | NM_181791.3 | 100% | 100% | |
| 4 | human | 353345 | GPR141 | G protein-coupled receptor 141 | XM_011515385.2 | 100% | 100% | |
| 5 | human | 353345 | GPR141 | G protein-coupled receptor 141 | XM_011515386.2 | 100% | 100% | |
| 6 | human | 353345 | GPR141 | G protein-coupled receptor 141 | XM_011515388.2 | 100% | 100% | |
| 7 | human | 353345 | GPR141 | G protein-coupled receptor 141 | XM_011515389.2 | 100% | 100% | |
| 8 | human | 353345 | GPR141 | G protein-coupled receptor 141 | XM_017012165.1 | 100% | 100% | |
| 9 | human | 353345 | GPR141 | G protein-coupled receptor 141 | XM_017012166.1 | 100% | 100% | |
| 10 | human | 353345 | GPR141 | G protein-coupled receptor 141 | XM_011515383.3 | 97.4% | 97.4% | 1_24del |
| 11 | human | 353345 | GPR141 | G protein-coupled receptor 141 | XM_017012164.1 | 97.4% | 97.4% | 1_24del |
| 12 | human | 353345 | GPR141 | G protein-coupled receptor 141 | XM_017012163.2 | 90.7% | 90.7% | 1_93del |
| 13 | human | 353345 | GPR141 | G protein-coupled receptor 141 | XM_017012161.2 | 84.2% | 84.2% | 1_171del |
| 14 | human | 353345 | GPR141 | G protein-coupled receptor 141 | XM_011515375.3 | 74.7% | 74.7% | 1_309del |
| 15 | human | 353345 | GPR141 | G protein-coupled receptor 141 | XM_011515374.3 | 72.6% | 72.6% | 1_345del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 987
- ORF length:
- 915
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgcctggc cacaatacct ccaggaattc ctcttgcgat cctatagtga 121 caccccactt aatcagcctc tacttcatag tgcttattgg cgggctggtg ggtgtcattt 181 ccattctttt cctcctggtg aaaatgaaca cccggtcagt gaccaccatg gcggtcatta 241 acttggtggt ggtccacagc gtttttctgc tgacagtgcc atttcgcttg acctacctca 301 tcaagaagac ttggatgttt gggctgccct tctgcaaatt tgtgagtgcc atgctgcaca 361 tccacatgta cctcacgttc ctattctatg tggtgatcct ggtcaccaga tacctcatct 421 tcttcaagtg caaagacaaa gtggaattct acagaaaact gcatgctgtg gctgccagtg 481 ctggcatgtg gacgctggtg attgtcattg tggtacccct ggttgtctcc cggtatggaa 541 tccatgagga atacaatgag gagcactgtt ttaaatttca caaagagctt gcttacacat 601 atgtgaaaat catcaactat atgatagtca tttttgtcat agccgttgct gtgattctgt 661 tggtcttcca ggTCTTCATC ATTATGTTGA TGGTGCAGAA GCTACGCCAC TCTTTACTAT 721 CCCACCAGGA GTTCTGGGCT CAGCTGAAAA ACCTATTTTT TATAGGGGTC ATCCTTGTTT 781 GTTTCCTTCC CTACCAGTTC TTTAGGATCT ATTACTTGAA TGTTGTGACG CATTCCAATG 841 CCTGTAACAG CAAGGTTGCA TTTTATAACG AAATCTTCTT GAGTGTAACA GCAATTAGCT 901 GCTATGATTT GCTTCTCTTT GTCTTTGGGG GAAGCCATTG GTTTAAGCAA AAGATAATTG 961 GCTTATGGAA TTGTGTTTTG TGCCGTTAGA ACCCAGCTTT CTTGTACAAA GTGGTTGATA 1021 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1081 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGACACTT 1141 CATGTCTTTC TTATAAGGTA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1201 tgaaagatt