Construct: ORF TRCN0000488331
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020321.1_s317c1
- DNA Barcode:
- TGACTTACCTACCTTGAGTTTCTC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- CDK6 (1021)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488331
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1021 | CDK6 | cyclin dependent kinase 6 | NM_001145306.1 | 100% | 100% | |
| 2 | human | 1021 | CDK6 | cyclin dependent kinase 6 | NM_001259.8 | 100% | 100% | |
| 3 | human | 1021 | CDK6 | cyclin dependent kinase 6 | XM_006715835.2 | 100% | 100% | |
| 4 | mouse | 12571 | Cdk6 | cyclin-dependent kinase 6 | NM_009873.3 | 89.9% | 96.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1050
- ORF length:
- 978
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggagaag gacggcctgt gccgcgctga ccagcagtac gaatgcgtgg 121 cggagatcgg ggagggcgcc tatgggaagg tgttcaaggc ccgcgacttg aagaacggag 181 gccgtttcgt ggcgttgaag cgcgtgcggg tgcagaccgg cgaggagggc atgccgctct 241 ccaccatccg cgaggtggcg gtgctgaggc acctggagac cttcgagcac cccaacgtgg 301 tcaggttgtt tgatgtgtgc acagtgtcac gaacagacag agaaaccaaa ctaactttag 361 tgtttgaaca tgtcgatcaa gacttgacca cttacttgga taaagttcca gagcctggag 421 tgcccactga aaccataaag gatatgatgt ttcagcttct ccgaggtctg gactttcttc 481 attcacaccg agtagtgcat cgcgatctaa aaccacagaa cattctggtg accagcagcg 541 gacaaataaa actcgctgac ttcggccttg cccgcatcta tagtttccag atggctctaa 601 cctcagtggt cgtcacgctg tggtacagag cacccgaagt cttgctccag tccagctacg 661 ccacccccgt ggatctctgg agtgttggct gcatatttgc agaaatgttt cgtagaaagc 721 ctctttttcg tggaagttca gatgttgatc aactaggaaa aatcttggac gtgattggac 781 tcccaggaga agaagactgg cctagagatg ttgcccTTCC CAGGCAGGCT TTTCATTCAA 841 AATCTGCCCA ACCAATTGAG AAGTTTGTAA CAGATATCGA TGAACTAGGC AAAGACCTAC 901 TTCTGAAGTG TTTGACATTT AACCCAGCCA AAAGAATATC TGCCTACAGT GCCCTGTCTC 961 ACCCATACTT CCAGGACCTG GAAAGGTGCA AAGAAAACCT GGATTCCCAC CTGCCGCCCA 1021 GCCAGAACAC CTCGGAGCTG AATACAGCCT GAGACCCAGC TTTCTTGTAC AAAGTGGTTG 1081 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1141 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGATG 1201 ACTTACCTAC CTTGAGTTTC TCACGCGTTA AGTCgacaat caacctctgg attacaaaat 1261 ttgtgaaaga tt