Transcript: Human XM_006715835.2

PREDICTED: Homo sapiens cyclin dependent kinase 6 (CDK6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDK6 (1021)
Length:
11834
CDS:
638..1618

Additional Resources:

NCBI RefSeq record:
XM_006715835.2
NBCI Gene record:
CDK6 (1021)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715835.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009877 GAGTAGTGCATCGCGATCTAA pLKO.1 1056 CDS 100% 5.625 7.875 N CDK6 n/a
2 TRCN0000039743 CGATCAAGACTTGACCACTTA pLKO.1 940 CDS 100% 4.950 6.930 N CDK6 n/a
3 TRCN0000039747 CGTGGAAGTTCAGATGTTGAT pLKO.1 1295 CDS 100% 4.950 6.930 N CDK6 n/a
4 TRCN0000196337 GTAACAGATATCGATGAACTA pLKO.1 1433 CDS 100% 4.950 6.930 N CDK6 n/a
5 TRCN0000194866 CAGATGTTGATCAACTAGGAA pLKO.1 1305 CDS 100% 3.000 4.200 N CDK6 n/a
6 TRCN0000199114 CCAGAACACCTCGGAGCTGAA pLKO.1 1588 CDS 100% 1.350 1.080 N CDK6 n/a
7 TRCN0000194933 CCAAACTAACTTTAGTGTTTG pLKO.1 912 CDS 100% 1.080 0.864 N CDK6 n/a
8 TRCN0000194893 CATGAGATGTTCCTATCTTAA pLKO.1 5009 3UTR 100% 13.200 9.240 N CDK6 n/a
9 TRCN0000039746 CTTCTGAAGTGTTTGACATTT pLKO.1 1466 CDS 100% 13.200 9.240 N CDK6 n/a
10 TRCN0000023152 CTTGACCACTTACTTGGATAA pLKO.1 949 CDS 100% 10.800 7.560 N Cdk6 n/a
11 TRCN0000196261 GAGAAGTTTGTAACAGATATC pLKO.1 1424 CDS 100% 10.800 7.560 N CDK6 n/a
12 TRCN0000196617 GCAGAAATGTTTCGTAGAAAG pLKO.1 1265 CDS 100% 10.800 7.560 N CDK6 n/a
13 TRCN0000055435 TCTGGAGTGTTGGCTGCATAT pLKO.1 1242 CDS 100% 10.800 7.560 N CDK6 n/a
14 TRCN0000039745 CAACCAATTGAGAAGTTTGTA pLKO.1 1415 CDS 100% 5.625 3.938 N CDK6 n/a
15 TRCN0000039744 GACCTGGAAAGGTGCAAAGAA pLKO.1 1541 CDS 100% 5.625 3.938 N CDK6 n/a
16 TRCN0000000485 CCACTGAAACCATAAAGGATA pLKO.1 990 CDS 100% 4.950 3.465 N CDK6 n/a
17 TRCN0000000486 CGAACAGACAGAGAAACCAAA pLKO.1 896 CDS 100% 4.950 3.465 N CDK6 n/a
18 TRCN0000000487 GAAGAAGACTGGCCTAGAGAT pLKO.1 1355 CDS 100% 4.950 3.465 N CDK6 n/a
19 TRCN0000010473 TTAAGCTGATCCTGCGGAGAA pLKO.1 1635 3UTR 100% 4.050 2.835 N CDK6 n/a
20 TRCN0000010074 TCGATGAACTAGGCAAAGACC pLKO.1 1443 CDS 100% 2.640 1.848 N CDK6 n/a
21 TRCN0000010081 GTCTCACCCATACTTCCAGGA pLKO.1 1522 CDS 100% 2.160 1.512 N CDK6 n/a
22 TRCN0000009878 CCATACTTCCAGGACCTGGAA pLKO.1 1529 CDS 100% 0.264 0.185 N CDK6 n/a
23 TRCN0000000488 CAGACAGAGAAACCAAACTAA pLKO.1 900 CDS 100% 5.625 3.375 N CDK6 n/a
24 TRCN0000010082 GACTTTCTTCATTCACACCGA pLKO.1 1037 CDS 100% 0.660 0.396 N CDK6 n/a
25 TRCN0000023151 GCAAAGACCTACTTCTGAAAT pLKO.1 1455 CDS 100% 13.200 9.240 N Cdk6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715835.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00279 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00279 pLX_304 57.2% 100% 100% V5 n/a
3 TRCN0000481165 GTGTACGCCCGTGATCTCAGACTC pLX_317 45.8% 100% 100% V5 n/a
4 ccsbBroadEn_14576 pDONR223 0% 100% 100% None n/a
5 ccsbBroad304_14576 pLX_304 15.7% 100% 100% V5 n/a
6 TRCN0000467546 AAAACAAGAACATTCTAGACCTTG pLX_317 33.3% 100% 100% V5 n/a
7 TRCN0000488331 TGACTTACCTACCTTGAGTTTCTC pLX_317 24.5% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV