Construct: ORF TRCN0000488373
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020704.1_s317c1
- DNA Barcode:
- AACTGTTCTCACTGAACCGCACCA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- MARK3 (4140)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488373
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4140 | MARK3 | microtubule affinity regula... | NM_002376.6 | 100% | 100% | |
| 2 | human | 4140 | MARK3 | microtubule affinity regula... | XM_005267641.5 | 98.7% | 98.7% | 1843_1869del |
| 3 | human | 4140 | MARK3 | microtubule affinity regula... | NM_001128919.2 | 97.9% | 97.9% | 1843_1887del |
| 4 | human | 4140 | MARK3 | microtubule affinity regula... | NM_001128920.2 | 97.8% | 97.8% | 1108_1109ins48 |
| 5 | human | 4140 | MARK3 | microtubule affinity regula... | NM_001128918.3 | 96.8% | 96.8% | 1843_1914del |
| 6 | human | 4140 | MARK3 | microtubule affinity regula... | XM_017021292.2 | 96.6% | 96.6% | 1108_1109ins48;1795_1821del |
| 7 | human | 4140 | MARK3 | microtubule affinity regula... | XM_017021291.2 | 95.8% | 95.8% | 1108_1109ins48;1795_1839del |
| 8 | human | 4140 | MARK3 | microtubule affinity regula... | XM_024449583.1 | 94.8% | 94.5% | (many diffs) |
| 9 | human | 4140 | MARK3 | microtubule affinity regula... | XM_005267642.5 | 94.6% | 94.6% | 1108_1109ins48;1795_1866del |
| 10 | human | 4140 | MARK3 | microtubule affinity regula... | XM_017021293.1 | 94.5% | 94.3% | (many diffs) |
| 11 | human | 4140 | MARK3 | microtubule affinity regula... | XM_017021298.2 | 91.2% | 91.2% | 51_52ins192 |
| 12 | human | 4140 | MARK3 | microtubule affinity regula... | XM_017021296.2 | 90.1% | 90.1% | 51_52ins192;1651_1677del |
| 13 | human | 4140 | MARK3 | microtubule affinity regula... | XM_017021295.2 | 89.3% | 89.3% | 51_52ins192;1651_1695del |
| 14 | human | 4140 | MARK3 | microtubule affinity regula... | XM_017021294.2 | 88.3% | 88.3% | 51_52ins192;1651_1722del |
| 15 | human | 4140 | MARK3 | microtubule affinity regula... | XM_005267643.5 | 88.2% | 88.2% | 1584_1585ins258 |
| 16 | human | 4140 | MARK3 | microtubule affinity regula... | NM_001128921.2 | 88% | 88% | 537_538ins237;1606_1632del |
| 17 | human | 4140 | MARK3 | microtubule affinity regula... | XM_017021299.2 | 87.2% | 87.2% | 51_52ins192;916_917ins48;1603_1647del |
| 18 | human | 4140 | MARK3 | microtubule affinity regula... | XM_017021297.2 | 86.1% | 86.1% | 51_52ins192;916_917ins48;1603_1674del |
| 19 | human | 4140 | MARK3 | microtubule affinity regula... | XM_011536769.3 | 86.1% | 86% | 0_1ins241;2delT;1603_1674del |
| 20 | human | 4140 | MARK3 | microtubule affinity regula... | XM_024449587.1 | 82% | 82% | 0_1ins393 |
| 21 | human | 4140 | MARK3 | microtubule affinity regula... | XM_024449586.1 | 81% | 81% | 0_1ins393;1450_1476del |
| 22 | human | 4140 | MARK3 | microtubule affinity regula... | XM_024449585.1 | 80.3% | 80.3% | 0_1ins393;1450_1494del |
| 23 | human | 4140 | MARK3 | microtubule affinity regula... | XM_017021301.2 | 79.4% | 79.4% | 0_1ins393;1450_1521del |
| 24 | human | 4140 | MARK3 | microtubule affinity regula... | XM_024449584.1 | 79.4% | 79.4% | 0_1ins393;1450_1521del |
| 25 | human | 4140 | MARK3 | microtubule affinity regula... | XM_017021308.2 | 78.8% | 78.8% | 0_1ins393;715_716ins48;1402_1428del |
| 26 | human | 4140 | MARK3 | microtubule affinity regula... | XM_024449590.1 | 78.3% | 77.9% | (many diffs) |
| 27 | human | 4140 | MARK3 | microtubule affinity regula... | XM_024449591.1 | 78.3% | 77.9% | (many diffs) |
| 28 | human | 4140 | MARK3 | microtubule affinity regula... | XM_024449588.1 | 78.2% | 78.2% | 0_1ins393;715_716ins48;1402_1446del |
| 29 | human | 4140 | MARK3 | microtubule affinity regula... | XM_024449589.1 | 76.7% | 76.3% | (many diffs) |
| 30 | human | 4140 | MARK3 | microtubule affinity regula... | XM_017021306.2 | 75.8% | 75.4% | (many diffs) |
| 31 | human | 4140 | MARK3 | microtubule affinity regula... | XM_017021307.2 | 75.8% | 75.4% | (many diffs) |
| 32 | mouse | 17169 | Mark3 | MAP/microtubule affinity re... | NM_022801.4 | 89.9% | 96.9% | (many diffs) |
| 33 | mouse | 17169 | Mark3 | MAP/microtubule affinity re... | NM_021516.4 | 88.1% | 95% | (many diffs) |
| 34 | mouse | 17169 | Mark3 | MAP/microtubule affinity re... | XM_006515518.3 | 87.8% | 94.7% | (many diffs) |
| 35 | mouse | 17169 | Mark3 | MAP/microtubule affinity re... | XM_006515515.3 | 87% | 93.8% | (many diffs) |
| 36 | mouse | 17169 | Mark3 | MAP/microtubule affinity re... | XM_006515517.3 | 85% | 91.7% | (many diffs) |
| 37 | mouse | 17169 | Mark3 | MAP/microtubule affinity re... | XM_006515514.3 | 83.8% | 90.4% | (many diffs) |
| 38 | mouse | 17169 | Mark3 | MAP/microtubule affinity re... | XM_006515512.3 | 82.2% | 88.7% | (many diffs) |
| 39 | mouse | 17169 | Mark3 | MAP/microtubule affinity re... | XM_006515511.3 | 81.3% | 87.7% | (many diffs) |
| 40 | mouse | 17169 | Mark3 | MAP/microtubule affinity re... | XM_006515513.3 | 79.4% | 85.7% | (many diffs) |
| 41 | mouse | 17169 | Mark3 | MAP/microtubule affinity re... | XM_006515519.1 | 64.1% | 69.4% | (many diffs) |
| 42 | mouse | 17169 | Mark3 | MAP/microtubule affinity re... | XM_006515522.3 | 52.4% | 56.5% | (many diffs) |
| 43 | mouse | 17169 | Mark3 | MAP/microtubule affinity re... | XM_011244006.1 | 40.9% | 37.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 2259
- ORF length:
- 2187
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgtccact aggaccccat tgccaacggt gaatgaacga gacactgaaa 121 accacacgtc acatggagat gggcgtcaag aagttacctc tcgtaccagc cgctcaggag 181 ctcggtgtag aaactctata gcctcctgtg cagatgaaca acctcacatc ggaaactaca 241 gactgttgaa aacaatcggc aaggggaatt ttgcaaaagt aaaattggca agacatatcc 301 ttacaggcag agaggttgca ataaaaataa ttgacaaaac tcagttgaat ccaacaagtc 361 tacaaaagct cttcagagaa gtaagaataa tgaagatttt aaatcatccc aatatagtga 421 agttattcga agtcattgaa actgaaaaaa cactctacct aatcatggaa tatgcaagtg 481 gaggtgaagt atttgactat ttggttgcac atggcaggat gaaggaaaaa gaagcaagat 541 ctaaatttag acagattgtg tctgcagttc aatactgcca tcagaaacgg atcgtacatc 601 gagacctcaa ggctgaaaat ctattgttag atgccgatat gaacattaaa atagcagatt 661 tcggttttag caatgaattt actgttggcg gtaaactcga cacgttttgt ggcagtcctc 721 catacgcagc acctgagctc ttccagggca agaaatatga cgggccagaa gtggatgtgt 781 ggagtctggg ggtcatttta tacacactag tcagtggctc acttcccttt gatgggcaaa 841 acctaaagga actgagagag agagtattaa gagggaaata cagaattccc ttctacatgt 901 ctacagactg tgaaaacctt ctcaaacgtt tcctggtgct aaatccaatt aaacgcggca 961 ctctagagca aatcatgaag gacaggtgga tcaatgcagg gcatgaagaa gatgaactca 1021 aaccatttgt tgaaccagag ctagacatct cagaccaaaa aagaatagat attatggtgg 1081 gaatgggata ttcacaagaa gaaattcaag aatctcttag taagatgaaa tacgatgaaa 1141 tcacagctac atatttgtta ttggggagaa aatcttcaga gctggatgct agtgattcca 1201 gttctagcag caatctttca cttgctaagg ttaggccgag cagtgatctc aacaacagta 1261 ctggccagtc tcctcaccac aaagtgcaga gaagtgtttc ttcaagccaa aagcaaagac 1321 gctacagtga ccatgctgga ccagctattc cttctgttgt ggcgtatccg aaaaggagtc 1381 agaccagcac tgcagatagt gacctcaaag aagatggaat ttcctcccgg aaatcaagtg 1441 gcagtgctgt tggaggaaag ggaattgctc cagccagtcc catgcttggg aatgcaagta 1501 atcctaataa ggcggatatt cctgaacgca agaaaagctc cactgtccct agtagtaaca 1561 cagcatctgg tggaatgaca cgacgaaata cttatgtttg cagtgagaga actacagctg 1621 atagacactc agtgattcag aatggcaaag aaaacagcac tattcctgat cagagaactc 1681 cagttgcttc aacacacagt atcagtagtg cagccacccc agatcgaatc cgcttcccaa 1741 gaggcactgc cagtcgtagc actttccacg gccagccccg ggaacggcga accgcaacat 1801 ataatggccc tcctgcctct cccagcctgt cccatgaagc cacaccattg tcccagactc 1861 gaagccgagg ctccactaat ctctttagta aattaacttc aaaactcaca aggagtcgca 1921 atgtatctgc tgagcaaaaa gatgaaaaca aagaagcaaa gcctcgatcc cTACGCTTCA 1981 CCTGGAGCAT GAAAACCACT AGTTCAATGG ATCCCGGGGA CATGATGCGG GAAATCCGCA 2041 AAGTGTTGGA CGCCAATAAC TGCGACTATG AGCAGAGGGA GCGCTTCTTG CTCTTCTGCG 2101 TCCACGGAGA TGGGCACGCG GAGAACCTCG TGCAGTGGGA AATGGAAGTG TGCAAGCTGC 2161 CAAGACTGTC TCTGAACGGG GTCCGGTTTA AGCGGATATC GGGGACATCC ATAGCCTTCA 2221 AAAATATTGC TTCCAAAATT GCCAATGAGC TAAAGCTGTA GAACCCAGCT TTCTTGTACA 2281 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 2341 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 2401 AGGACGAAAC TGTTCTCACT GAACCGCACC AACGCGTTAA GTCgacaatc aacctctgga 2461 ttacaaaatt tgtgaaagat t