Transcript: Human XM_024449588.1

PREDICTED: Homo sapiens microtubule affinity regulating kinase 3 (MARK3), transcript variant X20, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MARK3 (4140)
Length:
3351
CDS:
954..2747

Additional Resources:

NCBI RefSeq record:
XM_024449588.1
NBCI Gene record:
MARK3 (4140)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449588.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355523 ATCCTAATAAGGCGGATATTC pLKO_005 1942 CDS 100% 13.200 18.480 N MARK3 n/a
2 TRCN0000355571 GTGGAATGACACGACGAAATA pLKO_005 2011 CDS 100% 13.200 18.480 N MARK3 n/a
3 TRCN0000001566 CCAATTAAACGCGGCACTCTA pLKO.1 1434 CDS 100% 4.950 6.930 N MARK3 n/a
4 TRCN0000378206 ACGCCAATAACTGCGACTATG pLKO_005 2536 CDS 100% 10.800 8.640 N MARK3 n/a
5 TRCN0000195063 CCTTAAGACCAGTTCATAGTT pLKO.1 3176 3UTR 100% 5.625 4.500 N MARK3 n/a
6 TRCN0000221201 CGGAAACTACAGACTGTTGAA pLKO.1 768 5UTR 100% 4.950 3.960 N Mark3 n/a
7 TRCN0000196540 GAATTTACTGTTGGCGGTAAA pLKO.1 1164 CDS 100% 1.080 0.864 N MARK3 n/a
8 TRCN0000196456 GATGCCGATATGAACATTAAA pLKO.1 1119 CDS 100% 15.000 10.500 N MARK3 n/a
9 TRCN0000355524 GGTGAAGTATTTGACTATTTG pLKO_005 972 CDS 100% 13.200 9.240 N MARK3 n/a
10 TRCN0000378657 TATGGTGGGAATGGGATATTC pLKO_005 1562 CDS 100% 13.200 9.240 N Mark3 n/a
11 TRCN0000001564 TGTGTGTGAAGTGGTGTATAT pLKO.1 3038 3UTR 100% 13.200 9.240 N MARK3 n/a
12 TRCN0000196541 GCAATGTATCTGCTGAGCAAA pLKO.1 2404 CDS 100% 4.950 3.465 N MARK3 n/a
13 TRCN0000001567 TGAATGAACGAGACACTGAAA pLKO.1 638 5UTR 100% 4.950 2.970 N MARK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449588.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06560 pDONR223 100% 78.2% 78.2% None 0_1ins393;715_716ins48;1402_1446del n/a
2 ccsbBroad304_06560 pLX_304 0% 78.2% 78.2% V5 0_1ins393;715_716ins48;1402_1446del n/a
3 TRCN0000479389 CTCCATTCAAAATAGAAACCTAGT pLX_317 13.5% 78.2% 78.2% V5 0_1ins393;715_716ins48;1402_1446del n/a
4 ccsbBroadEn_14693 pDONR223 0% 78.2% 78.2% None 0_1ins393;715_716ins48;1402_1446del n/a
5 ccsbBroad304_14693 pLX_304 0% 78.2% 78.2% V5 0_1ins393;715_716ins48;1402_1446del n/a
6 TRCN0000474844 TTTGACCTTCCTATAGCGGCACGA pLX_317 3.6% 78.2% 78.2% V5 0_1ins393;715_716ins48;1402_1446del n/a
7 TRCN0000488373 AACTGTTCTCACTGAACCGCACCA pLX_317 13.5% 78.2% 78.2% V5 (not translated due to prior stop codon) 0_1ins393;715_716ins48;1402_1446del n/a
Download CSV