Transcript: Human NM_001128918.3

Homo sapiens microtubule affinity regulating kinase 3 (MARK3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
MARK3 (4140)
Length:
3481
CDS:
616..2877

Additional Resources:

NCBI RefSeq record:
NM_001128918.3
NBCI Gene record:
MARK3 (4140)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146805 AGGACAGGTGGATCAATGCA pXPR_003 GGG 924 41% 10 1.1522 MARK3 MARK3 77717
2 BRDN0001147831 AGTGATCTCAACAACAGTAC pXPR_003 TGG 1187 52% 12 0.3378 MARK3 MARK3 77718
3 BRDN0001146658 ACTGTTGAAAACAATCGGCA pXPR_003 AGG 187 8% 2 0.007 MARK3 MARK3 77719
4 BRDN0001145035 TTTGACTATTTGGTTGCACA pXPR_003 TGG 437 19% 6 -0.6630 MARK3 MARK3 77716
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001128918.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355523 ATCCTAATAAGGCGGATATTC pLKO_005 2045 CDS 100% 13.200 18.480 N MARK3 n/a
2 TRCN0000355571 GTGGAATGACACGACGAAATA pLKO_005 2114 CDS 100% 13.200 18.480 N MARK3 n/a
3 TRCN0000001566 CCAATTAAACGCGGCACTCTA pLKO.1 1489 CDS 100% 4.950 6.930 N MARK3 n/a
4 TRCN0000378206 ACGCCAATAACTGCGACTATG pLKO_005 2666 CDS 100% 10.800 8.640 N MARK3 n/a
5 TRCN0000195063 CCTTAAGACCAGTTCATAGTT pLKO.1 3306 3UTR 100% 5.625 4.500 N MARK3 n/a
6 TRCN0000221201 CGGAAACTACAGACTGTTGAA pLKO.1 774 CDS 100% 4.950 3.960 N Mark3 n/a
7 TRCN0000196540 GAATTTACTGTTGGCGGTAAA pLKO.1 1219 CDS 100% 1.080 0.864 N MARK3 n/a
8 TRCN0000196456 GATGCCGATATGAACATTAAA pLKO.1 1174 CDS 100% 15.000 10.500 N MARK3 n/a
9 TRCN0000355524 GGTGAAGTATTTGACTATTTG pLKO_005 1027 CDS 100% 13.200 9.240 N MARK3 n/a
10 TRCN0000378657 TATGGTGGGAATGGGATATTC pLKO_005 1617 CDS 100% 13.200 9.240 N Mark3 n/a
11 TRCN0000001564 TGTGTGTGAAGTGGTGTATAT pLKO.1 3168 3UTR 100% 13.200 9.240 N MARK3 n/a
12 TRCN0000001565 CATCCCAATATAGTGAAGTTA pLKO.1 949 CDS 100% 5.625 3.938 N MARK3 n/a
13 TRCN0000196541 GCAATGTATCTGCTGAGCAAA pLKO.1 2534 CDS 100% 4.950 3.465 N MARK3 n/a
14 TRCN0000010641 CCAGTTCTAGCAGCAATCTTT pLKO.1 1742 CDS 100% 5.625 3.375 N MARK3 n/a
15 TRCN0000001567 TGAATGAACGAGACACTGAAA pLKO.1 644 CDS 100% 4.950 2.970 N MARK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001128918.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06560 pDONR223 100% 96.8% 96.8% None 1843_1914del n/a
2 ccsbBroad304_06560 pLX_304 0% 96.8% 96.8% V5 1843_1914del n/a
3 TRCN0000479389 CTCCATTCAAAATAGAAACCTAGT pLX_317 13.5% 96.8% 96.8% V5 1843_1914del n/a
4 ccsbBroadEn_14693 pDONR223 0% 96.8% 96.8% None 1843_1914del n/a
5 ccsbBroad304_14693 pLX_304 0% 96.8% 96.8% V5 1843_1914del n/a
6 TRCN0000474844 TTTGACCTTCCTATAGCGGCACGA pLX_317 3.6% 96.8% 96.8% V5 1843_1914del n/a
7 TRCN0000488373 AACTGTTCTCACTGAACCGCACCA pLX_317 13.5% 96.8% 96.8% V5 (not translated due to prior stop codon) 1843_1914del n/a
Download CSV