Construct: ORF TRCN0000488377
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020183.1_s317c1
- DNA Barcode:
- TACTCTATAAACCTTGCAATCCGC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- CDK7 (1022)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488377
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1022 | CDK7 | cyclin dependent kinase 7 | NM_001799.4 | 99.9% | 100% | 99C>T |
| 2 | human | 1022 | CDK7 | cyclin dependent kinase 7 | NM_001324069.2 | 87.9% | 87.8% | 0_1ins123;2_3delTGinsAA |
| 3 | human | 1022 | CDK7 | cyclin dependent kinase 7 | NM_001324070.2 | 83.4% | 83.5% | 99C>T;126_127ins171 |
| 4 | human | 1022 | CDK7 | cyclin dependent kinase 7 | NM_001324071.2 | 83.4% | 74% | 0_1ins34;65C>T;125_126ins137 |
| 5 | human | 1022 | CDK7 | cyclin dependent kinase 7 | NM_001324072.1 | 73.1% | 73.1% | 0_1ins279 |
| 6 | human | 1022 | CDK7 | cyclin dependent kinase 7 | NM_001324074.2 | 73.1% | 73.1% | 0_1ins279 |
| 7 | human | 1022 | CDK7 | cyclin dependent kinase 7 | NM_001324075.2 | 73.1% | 73.1% | 0_1ins279 |
| 8 | human | 1022 | CDK7 | cyclin dependent kinase 7 | NM_001324077.1 | 73.1% | 73.1% | 0_1ins279 |
| 9 | human | 1022 | CDK7 | cyclin dependent kinase 7 | NM_001324078.2 | 73.1% | 73.1% | 0_1ins279 |
| 10 | human | 1022 | CDK7 | cyclin dependent kinase 7 | XM_011543094.2 | 66.1% | 66.1% | 0_1ins351 |
| 11 | human | 1022 | CDK7 | cyclin dependent kinase 7 | NR_136690.2 | 64.3% | (many diffs) | |
| 12 | mouse | 12572 | Cdk7 | cyclin-dependent kinase 7 | NM_009874.3 | 87.5% | 95% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1110
- ORF length:
- 1038
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggctctg gacgtgaagt ctcgggcaaa gcgttatgag aagctggact 121 tccttgggga gggacagttt gccaccgttt acaaggccag agataagaat accaaccaaa 181 ttgtcgccat taagaaaatc aaacttggac atagatcaga agctaaagat ggtataaata 241 gaaccgcctt aagagagata aaattattac aggagctaag tcatccaaat ataattggtc 301 tccttgatgc ttttggacat aaatctaata ttagccttgt ctttgatttt atggaaactg 361 atctagaggt tataataaag gataatagtc ttgtgctgac accatcacac atcaaagcct 421 acatgttgat gactcttcaa ggattagaat atttacatca acattggatc ctacataggg 481 atctgaaacc aaacaacttg ttgctagatg aaaatggagt tctaaaactg gcagattttg 541 gcctggccaa atcttttggg agccccaata gagcttatac acatcaggtt gtaaccaggt 601 ggtatcgggc ccccgagtta ctatttggag ctaggatgta tggtgtaggt gtggacatgt 661 gggctgttgg ctgtatatta gcagagttac ttctaagggt tccttttttg ccaggagatt 721 cagaccttga tcagctaaca agaatatttg aaactttggg cacaccaact gaggaacagt 781 ggccggacat gtgtagtctt ccagattatg tgacatttaa gagtttccct ggaatacctt 841 TGCATCACAT CTTCAGTGCA GCAGGAGACG ACTTACTAGA TCTCATACAA GGCTTATTCT 901 TATTTAATCC ATGTGCTCGA ATTACGGCCA CACAGGCACT GAAAATGAAG TATTTCAGTA 961 ATCGGCCAGG GCCAACACCT GGATGTCAGC TGCCAAGACC AAACTGTCCA GTGGAAACCT 1021 TAAAGGAGCA ATCAAATCCA GCTTTGGCAA TAAAAAGGAA AAGAACAGAG GCCTTAGAAC 1081 AAGGAGGATT GCCCAAGAAA CTAATTTTTT GAGACCCAGC TTTCTTGTAC AAAGTGGTTG 1141 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1201 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGATA 1261 CTCTATAAAC CTTGCAATCC GCACGCGTTA AGTCgacaat caacctctgg attacaaaat 1321 ttgtgaaaga tt