Construct: ORF TRCN0000488396
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021518.1_s317c1
- DNA Barcode:
- TCCCTAAGAACCTGCGTGCTTATG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- AKR1B10 (57016)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488396
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 57016 | AKR1B10 | aldo-keto reductase family ... | NM_020299.5 | 99.8% | 99.6% | 937A>G |
| 2 | human | 441282 | AKR1B15 | aldo-keto reductase family ... | NM_001367821.1 | 95.2% | 91.7% | (many diffs) |
| 3 | human | 57016 | AKR1B10 | aldo-keto reductase family ... | XM_011516416.1 | 87.5% | 87.3% | 230_231ins117;820A>G |
| 4 | human | 441282 | AKR1B15 | aldo-keto reductase family ... | NM_001080538.3 | 85.2% | 78.7% | (many diffs) |
| 5 | human | 441282 | AKR1B15 | aldo-keto reductase family ... | NM_001367820.1 | 85.2% | 78.7% | (many diffs) |
| 6 | human | 441282 | AKR1B15 | aldo-keto reductase family ... | XM_017012224.2 | 85.2% | 78.7% | (many diffs) |
| 7 | human | 57016 | AKR1B10 | aldo-keto reductase family ... | XR_927491.1 | 57.8% | (many diffs) | |
| 8 | human | 57016 | AKR1B10 | aldo-keto reductase family ... | XM_011516417.2 | 49% | 47.9% | (many diffs) |
| 9 | human | 441282 | AKR1B15 | aldo-keto reductase family ... | NM_001367822.1 | 30.9% | 26.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1017
- ORF length:
- 948
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat ggccacgttt gtggagctca gtaccaaagc caagatgccc attgtgggcc 121 tgggcacttg gaagtctcct cttggcaaag tgaaagaagc agtgaaggtg gccattgatg 181 caggatatcg gcacattgac tgtgcctatg tctatcagaa tgaacatgaa gtgggggaag 241 ccatccaaga gaagatccaa gagaaggctg tgaagcggga ggacctgttc atcgtcagca 301 agttgtggcc cactttcttt gagagacccc ttgtgaggaa agcctttgag aagaccctca 361 aggacctgaa gctgagctat ctggacgtct atcttattca ctggccacag ggattcaagt 421 ctggggatga ccttttcccc aaagatgata aaggtaatgc catcggtgga aaagcaacgt 481 tcttggatgc ctgggaggcc atggaggagc tggtggatga ggggctggtg aaagcccttg 541 gggtctccaa tttcagccac ttccagatcg agaagctctt gaacaaacct ggactgaaat 601 ataaaccagt gactaaccag gttgagtgtc acccatacct cacacaggag aaactgatcc 661 agtactgcca ctccaagggc atcaccgtta cggcctacag ccccctgggc tctccggata 721 gaccttgggc caagccagaa gacccttccc TGCTGGAGGA TCCCAAGATT AAGGAGATTG 781 CTGCAAAGCA CAAAAAAACC GCAGCCCAGG TTCTGATCCG TTTCCATATC CAGAGGAATG 841 TGATTGTCAT CCCCAAGTCT GTGACACCAG CACGCATTGT TGAGAACATT CAGGTCTTTG 901 ACTTTAAATT GAGTGATGAG GAGATGGCAA CCATACTCAG CTTCAACAGA AACTGGAGGG 961 CCTGTAACGT GTTGCAATCC TCTCATTTGG AAGACTATCC CTTCGATGCA GAATATTAGA 1021 ACCCAGCTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1081 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1141 TTTATATATC TTGTGGAAAG GACGATCCCT AAGAACCTGC GTGCTTATGA CGCGTTAAGT 1201 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt