Transcript: Human NM_001080538.3

Homo sapiens aldo-keto reductase family 1 member B15 (AKR1B15), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-14
Taxon:
Homo sapiens (human)
Gene:
AKR1B15 (441282)
Length:
1641
CDS:
287..1321

Additional Resources:

NCBI RefSeq record:
NM_001080538.3
NBCI Gene record:
AKR1B15 (441282)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001080538.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243645 GTGCCTATTTCTATGAGAATC pLKO_005 504 CDS 100% 10.800 7.560 N AKR1B15 n/a
2 TRCN0000243642 ATAAAGGTAATATGATCAGTG pLKO_005 750 CDS 100% 4.050 2.835 N AKR1B15 n/a
3 TRCN0000243644 ATGAGAATCAACATGAGGTGG pLKO_005 516 CDS 100% 2.160 1.512 N AKR1B15 n/a
4 TRCN0000257178 ATAGACCTTGGGCCAAACCTG pLKO_005 1020 CDS 100% 2.640 1.584 N AKR1B15 n/a
5 TRCN0000046346 GATCCCAAGATTAAGGAGATT pLKO.1 1061 CDS 100% 4.950 2.475 Y AKR1B10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080538.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08685 pDONR223 100% 85.2% 78.7% None (many diffs) n/a
2 ccsbBroad304_08685 pLX_304 0% 85.2% 78.7% V5 (many diffs) n/a
3 TRCN0000468390 ACCATGACGAGTCAAGCCACGCCC pLX_317 37% 85.2% 78.7% V5 (many diffs) n/a
4 TRCN0000488396 TCCCTAAGAACCTGCGTGCTTATG pLX_317 28.7% 85.2% 78.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000492060 CAACGATTTTCCCTCCTTGATTTA pLX_317 40.1% 85.1% 78.5% V5 (many diffs) n/a
Download CSV