Transcript: Human XR_927491.1

PREDICTED: Homo sapiens aldo-keto reductase family 1 member B10 (AKR1B10), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AKR1B10 (57016)
Length:
1638
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_927491.1
NBCI Gene record:
AKR1B10 (57016)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_927491.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046345 CGTGTTGCAATCCTCTCATTT pLKO.1 1264 3UTR 100% 13.200 18.480 N AKR1B10 n/a
2 TRCN0000046343 GCCTATGTCTATCAGAATGAA pLKO.1 451 3UTR 100% 5.625 4.500 N AKR1B10 n/a
3 TRCN0000046344 GCACGCATTGTTGAGAACATT pLKO.1 1166 3UTR 100% 5.625 3.375 N AKR1B10 n/a
4 TRCN0000046347 CAAAGTGAAAGAAGCAGTGAA pLKO.1 393 3UTR 100% 4.950 2.970 N AKR1B10 n/a
5 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 7 3UTR 100% 4.950 2.475 Y CFLAR n/a
6 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 7 3UTR 100% 4.950 2.475 Y C19orf31 n/a
7 TRCN0000046346 GATCCCAAGATTAAGGAGATT pLKO.1 1006 3UTR 100% 4.950 2.475 Y AKR1B10 n/a
8 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 153 3UTR 100% 10.800 5.400 Y SMIM11A n/a
9 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 5 3UTR 100% 4.950 2.475 Y ERN2 n/a
10 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 5 3UTR 100% 4.950 2.475 Y P3H4 n/a
11 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 5 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_927491.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08685 pDONR223 100% 57.8% None (many diffs) n/a
2 ccsbBroad304_08685 pLX_304 0% 57.8% V5 (many diffs) n/a
3 TRCN0000468390 ACCATGACGAGTCAAGCCACGCCC pLX_317 37% 57.8% V5 (many diffs) n/a
4 TRCN0000492060 CAACGATTTTCCCTCCTTGATTTA pLX_317 40.1% 57.8% V5 (many diffs) n/a
5 TRCN0000488396 TCCCTAAGAACCTGCGTGCTTATG pLX_317 28.7% 57.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV