Construct: ORF TRCN0000488424
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019602.1_s317c1
- DNA Barcode:
- TAAGACGTGTTATTACCAAAACTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GPR173 (54328)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488424
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54328 | GPR173 | G protein-coupled receptor 173 | NM_018969.5 | 99.7% | 99.7% | 87G>A;1062C>T;1119_1120insG |
| 2 | human | 54328 | GPR173 | G protein-coupled receptor 173 | XM_011530798.2 | 99.7% | 99.7% | 87G>A;1062C>T;1119_1120insG |
| 3 | mouse | 70771 | Gpr173 | G-protein coupled receptor 173 | NM_001313748.1 | 94.5% | 99.1% | (many diffs) |
| 4 | mouse | 70771 | Gpr173 | G-protein coupled receptor 173 | NM_027543.4 | 94.5% | 99.1% | (many diffs) |
| 5 | mouse | 70771 | Gpr173 | G-protein coupled receptor 173 | XM_006528981.3 | 94.5% | 99.1% | (many diffs) |
| 6 | mouse | 70771 | Gpr173 | G-protein coupled receptor 173 | XM_006528983.3 | 94.5% | 99.1% | (many diffs) |
| 7 | mouse | 70771 | Gpr173 | G-protein coupled receptor 173 | XM_011247871.2 | 94.5% | 99.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1197
- ORF length:
- 1122
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatggcc aacactaccg gagagcctga ggaggtgagc ggcgctctgt 121 ccccaccgtc cgcatcagct tatgtgaagc tggtactgct aggactgatt atgtgcgtga 181 gcctggcggg taacgccatc ttgtccctgc tggtgctcaa ggagcgtgcc ctgcacaagg 241 ctccttacta cttcctgctg gacctgtgcc tggccgatgg catacgctct gccgtctgct 301 tcccctttgt gctggcttct gtgcgccacg gctcttcatg gaccttcagt gcactcagct 361 gcaagattgt ggcctttatg gccgtgctct tttgcttcca tgcggccttc atgctgttct 421 gcatcagcgt cacccgctac atggccatcg cccaccaccg cttctacgcc aagcgcatga 481 cactctggac atgcgcggct gtcatctgca tggcctggac cctgtctgtg gccatggcct 541 tcccacctgt ctttgacgtg ggcacctaca agtttattcg ggaggaggac cagtgcatct 601 ttgagcatcg ctacttcaag gccaatgaca cgctgggctt catgcttatg ttggctgtgc 661 tcatggcagc tacccatgct gtctacggca agctgctcct cttcgagtat cgtcaccgca 721 agatgaagcc agtgcagatg gtgccagcca tcagccagaa ctggacattc catggtcccg 781 gggccaccgg ccaggctgct gccaactgga tcgccggctt tggccgtggg cccatgccac 841 caaccctgct ggGTATCCGG CAGAATGGGC ATGCAGCCAG CCGGCGGCTA CTGGGCATGG 901 ACGAGGTCAA GGGTGAAAAG CAGCTGGGCC GCATGTTCTA CGCGATCACA CTGCTCTTTC 961 TGCTCCTCTG GTCACCCTAC ATCGTGGCCT GCTACTGGCG AGTGTTTGTG AAAGCCTGTG 1021 CTGTGCCCCA CCGCTACCTG GCCACTGCTG TTTGGATGAG CTTCGCCCAG GCTGCCGTCA 1081 ACCCAATTGT CTGCTTCCTG CTCAACAAGG ACCTCAAGAA GTGCCTGAGG ACTCATGCCC 1141 CCTGCTGGGG CACAGGAGGT GCCCCGGCTC CCAGAGAACC CTACTGTGTC ATGGACCCAG 1201 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1261 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1321 TATCTTGTGG AAAGGACGAT AAGACGTGTT ATTACCAAAA CTTACGCGTT AAGTCgacaa 1381 tcaacctctg gattacaaaa tttgtgaaag att