Transcript: Mouse NM_027543.4

Mus musculus G-protein coupled receptor 173 (Gpr173), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Gpr173 (70771)
Length:
4868
CDS:
978..2099

Additional Resources:

NCBI RefSeq record:
NM_027543.4
NBCI Gene record:
Gpr173 (70771)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027543.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125041 GCCGAATGTTCTACGCGATTA pLKO.1 1831 CDS 100% 10.800 15.120 N Gpr173 n/a
2 TRCN0000125043 GCTGTAAGATTGTGGCCTTTA pLKO.1 1261 CDS 100% 10.800 7.560 N Gpr173 n/a
3 TRCN0000125042 GCATCGCTACTTCAAAGCAAA pLKO.1 1508 CDS 100% 4.950 3.465 N Gpr173 n/a
4 TRCN0000125040 CCTGCTTAACAAGGACCTCAA pLKO.1 2000 CDS 100% 4.050 2.835 N Gpr173 n/a
5 TRCN0000014376 CACTGCTGTTTGGATGAGCTT pLKO.1 1946 CDS 100% 2.640 1.848 N GPR173 n/a
6 TRCN0000125039 CCCACAATTATCCCTTGGGTT pLKO.1 3086 3UTR 100% 2.640 1.848 N Gpr173 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027543.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08366 pDONR223 100% 94.6% 99.4% None (many diffs) n/a
2 ccsbBroad304_08366 pLX_304 0% 94.6% 99.4% V5 (many diffs) n/a
3 TRCN0000474900 CCGATCATTGATCTAACTATTGGG pLX_317 39.8% 94.6% 99.4% V5 (many diffs) n/a
4 TRCN0000488801 CGGGATTTCCCTCACTCGGATCGA pLX_317 31.4% 94.6% 99.4% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488424 TAAGACGTGTTATTACCAAAACTT pLX_317 30.6% 94.5% 99.1% V5 (many diffs) n/a
Download CSV