Transcript: Human XM_011530798.2

PREDICTED: Homo sapiens G protein-coupled receptor 173 (GPR173), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPR173 (54328)
Length:
4269
CDS:
276..1397

Additional Resources:

NCBI RefSeq record:
XM_011530798.2
NBCI Gene record:
GPR173 (54328)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530798.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014375 CATCGCTACTTCAAGGCCAAT pLKO.1 807 CDS 100% 4.050 5.670 N GPR173 n/a
2 TRCN0000358092 GTACTGCTGGGACTGATTATG pLKO_005 354 CDS 100% 13.200 10.560 N GPR173 n/a
3 TRCN0000367826 ACGTGGGCACCTACAAGTTTA pLKO_005 757 CDS 100% 13.200 9.240 N GPR173 n/a
4 TRCN0000358093 AGCTGCTCCTCTTCGAGTATC pLKO_005 892 CDS 100% 10.800 7.560 N GPR173 n/a
5 TRCN0000014374 GCTGCAAGATTGTGGCCTTTA pLKO.1 559 CDS 100% 10.800 7.560 N GPR173 n/a
6 TRCN0000014373 ACCTGTAATCTAGGCACCTTT pLKO.1 1524 3UTR 100% 4.950 3.465 N GPR173 n/a
7 TRCN0000014376 CACTGCTGTTTGGATGAGCTT pLKO.1 1244 CDS 100% 2.640 1.848 N GPR173 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3427 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530798.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08366 pDONR223 100% 99.8% 100% None 87G>A;1062C>T n/a
2 ccsbBroad304_08366 pLX_304 0% 99.8% 100% V5 87G>A;1062C>T n/a
3 TRCN0000474900 CCGATCATTGATCTAACTATTGGG pLX_317 39.8% 99.8% 100% V5 87G>A;1062C>T n/a
4 TRCN0000488801 CGGGATTTCCCTCACTCGGATCGA pLX_317 31.4% 99.8% 100% V5 (not translated due to prior stop codon) 87G>A;1062C>T n/a
5 TRCN0000488424 TAAGACGTGTTATTACCAAAACTT pLX_317 30.6% 99.7% 99.7% V5 87G>A;1062C>T;1119_1120insG n/a
Download CSV