Construct: ORF TRCN0000488450
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021470.1_s317c1
- DNA Barcode:
- TCACCAAAAACACATCGTCTCATC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- PPARA (5465)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488450
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5465 | PPARA | peroxisome proliferator act... | NM_001001928.3 | 99.6% | 100% | 1404_1405insTGAGC |
| 2 | human | 5465 | PPARA | peroxisome proliferator act... | NM_001362872.2 | 99.6% | 100% | 1404_1405insTGAGC |
| 3 | human | 5465 | PPARA | peroxisome proliferator act... | NM_001362873.1 | 99.6% | 100% | 1404_1405insTGAGC |
| 4 | human | 5465 | PPARA | peroxisome proliferator act... | NM_005036.6 | 99.6% | 100% | 1404_1405insTGAGC |
| 5 | human | 5465 | PPARA | peroxisome proliferator act... | XM_005261656.3 | 99.6% | 100% | 1404_1405insTGAGC |
| 6 | human | 5465 | PPARA | peroxisome proliferator act... | XM_006724270.3 | 99.6% | 100% | 1404_1405insTGAGC |
| 7 | human | 5465 | PPARA | peroxisome proliferator act... | XM_011530239.2 | 99.6% | 100% | 1404_1405insTGAGC |
| 8 | human | 5465 | PPARA | peroxisome proliferator act... | XM_011530240.2 | 99.6% | 100% | 1404_1405insTGAGC |
| 9 | human | 5465 | PPARA | peroxisome proliferator act... | XM_011530241.2 | 99.6% | 100% | 1404_1405insTGAGC |
| 10 | human | 5465 | PPARA | peroxisome proliferator act... | XM_011530242.2 | 99.6% | 100% | 1404_1405insTGAGC |
| 11 | human | 5465 | PPARA | peroxisome proliferator act... | XM_011530243.2 | 99.6% | 100% | 1404_1405insTGAGC |
| 12 | human | 5465 | PPARA | peroxisome proliferator act... | XM_011530244.2 | 70.6% | 64.4% | 0_1ins406;102_105delGGTA;1002_1003insTGAGC |
| 13 | human | 5465 | PPARA | peroxisome proliferator act... | XM_011530245.2 | 70.6% | 64.4% | 0_1ins406;102_105delGGTA;1002_1003insTGAGC |
| 14 | human | 5465 | PPARA | peroxisome proliferator act... | XM_017028839.1 | 70.6% | 64.4% | 0_1ins406;102_105delGGTA;1002_1003insTGAGC |
| 15 | human | 5465 | PPARA | peroxisome proliferator act... | XM_024452252.1 | 70.6% | 64.4% | 0_1ins406;102_105delGGTA;1002_1003insTGAGC |
| 16 | human | 5465 | PPARA | peroxisome proliferator act... | XR_937869.2 | 57.3% | (many diffs) | |
| 17 | human | 5465 | PPARA | peroxisome proliferator act... | XR_937870.2 | 57.2% | 1_318del;826_827ins203;1306_1307ins218 | |
| 18 | human | 5465 | PPARA | peroxisome proliferator act... | XM_024452253.1 | 56.4% | 51.2% | 0_1ins406;102_103ins203;795_796insTGAGC |
| 19 | human | 5465 | PPARA | peroxisome proliferator act... | XR_001755253.1 | 13.9% | 1_318del;826_829delGGTA;1731_10105delinsC | |
| 20 | mouse | 19013 | Ppara | peroxisome proliferator act... | NM_001113418.1 | 85.2% | 92.3% | (many diffs) |
| 21 | mouse | 19013 | Ppara | peroxisome proliferator act... | NM_011144.6 | 85.2% | 92.3% | (many diffs) |
| 22 | mouse | 19013 | Ppara | peroxisome proliferator act... | XM_006520619.1 | 85.2% | 92.3% | (many diffs) |
| 23 | mouse | 19013 | Ppara | peroxisome proliferator act... | XM_006520620.3 | 85.2% | 92.3% | (many diffs) |
| 24 | mouse | 19013 | Ppara | peroxisome proliferator act... | XM_006520621.3 | 85.2% | 92.3% | (many diffs) |
| 25 | mouse | 19013 | Ppara | peroxisome proliferator act... | XM_006520622.3 | 85.2% | 92.3% | (many diffs) |
| 26 | mouse | 19013 | Ppara | peroxisome proliferator act... | XM_006520623.3 | 85.2% | 92.3% | (many diffs) |
| 27 | mouse | 19013 | Ppara | peroxisome proliferator act... | XM_011245516.2 | 85.2% | 92.3% | (many diffs) |
| 28 | mouse | 19013 | Ppara | peroxisome proliferator act... | XM_011245517.2 | 85.2% | 92.3% | (many diffs) |
| 29 | mouse | 19013 | Ppara | peroxisome proliferator act... | XM_011245519.2 | 85.2% | 92.3% | (many diffs) |
| 30 | mouse | 19013 | Ppara | peroxisome proliferator act... | XM_006520624.3 | 73.1% | 74.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1470
- ORF length:
- 1404
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaacaat 61 tgaccatggt ggacacggaa agcccactct gccccctctc cccactcgag gccggcgatc 121 tagagagccc gttatctgaa gagttcctgc aagaaatggg aaacatccaa gagatttcgc 181 aatccatcgg cgaggatagt tctggaagct ttggctttac ggaataccag tatttaggaa 241 gctgtcctgg ctcagatggc tcggtcatca cggacacgct ttcaccagct tcgagcccct 301 cctcggtgac ttatcctgtg gtccccggca gcgtggacga gtctcccagt ggagcattga 361 acatcgaatg tagaatctgc ggggacaagg cctcaggcta tcattacgga gtccacgcgt 421 gtgaaggctg caagggcttc tttcggcgaa cgattcgact caagctggtg tatgacaagt 481 gcgaccgcag ctgcaagatc cagaaaaaga acagaaacaa atgccagtat tgtcgatttc 541 acaagtgcct ttctgtcggg atgtcacaca acgcgattcg ttttggacga atgccaagat 601 ctgagaaagc aaaactgaaa gcagaaattc ttacctgtga acatgacata gaagattctg 661 aaactgcaga tctcaaatct ctggccaaga gaatctacga ggcctacttg aagaacttca 721 acatgaacaa ggtcaaagcc cgggtcatcc tctcaggaaa ggccagtaac aatccacctt 781 ttgtcataca tgatatggag acactgtgta tggctgagaa gacgctggtg gccaagctgg 841 tggccaatgg catccagaac aaggaggcgg aggtccgcat ctttcactgc tgccagtgca 901 cgtcagtgga gaccgtcacg gagctcacgg aattcgccaa ggccatccca ggcttcgcaa 961 acttggacct gaacgatcaa gtgacattgc taaaatacgg agtttatgag gccatattcg 1021 ccatgctgtc ttctgtgatg aacaaagacg ggatgctggt agcgtatgga aatgggttta 1081 taactcgtga atTCCTAAAA AGCCTAAGGA AACCGTTCTG TGATATCATG GAACCCAAGT 1141 TTGATTTTGC CATGAAGTTC AATGCACTGG AACTGGATGA CAGTGATATC TCCCTTTTTG 1201 TGGCTGCTAT CATTTGCTGT GGAGATCGTC CTGGCCTTCT AAACGTAGGA CACATTGAAA 1261 AAATGCAGGA GGGTATTGTA CATGTGCTCA GACTCCACCT GCAGAGCAAC CACCCGGACG 1321 ATATCTTTCT CTTCCCAAAA CTTCTTCAAA AAATGGCAGA CCTCCGGCAG CTGGTGACGG 1381 AGCATGCGCA GCTGGTGCAG ATCATCAAGA AGACGGAGTC GGATGCTGCG CTGCACCCGC 1441 TACTGCAGGA GATCTACAGG GACATGTACT GAGCTAGCGA CCCAGCTTTC TTGTACAAAG 1501 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1561 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1621 ACGATCACCA AAAACACATC GTCTCATCAC GCGTTAAGTC gacaatcaac ctctggatta 1681 caaaatttgt gaaagatt