Transcript: Human XM_006724270.3

PREDICTED: Homo sapiens peroxisome proliferator activated receptor alpha (PPARA), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPARA (5465)
Length:
3156
CDS:
232..1638

Additional Resources:

NCBI RefSeq record:
XM_006724270.3
NBCI Gene record:
PPARA (5465)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006724270.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244947 GCGTATGGAAATGGGTTTATA pLKO_005 1228 CDS 100% 15.000 21.000 N PPARA n/a
2 TRCN0000244948 TGTAGGTAACCGGCATATTAT pLKO_005 1767 3UTR 100% 15.000 21.000 N PPARA n/a
3 TRCN0000244946 GCTTTACGGAATACCAGTATT pLKO_005 380 CDS 100% 13.200 18.480 N PPARA n/a
4 TRCN0000001666 GATTCGACTCAAGCTGGTGTA pLKO.1 618 CDS 100% 4.050 5.670 N PPARA n/a
5 TRCN0000001667 GTAGCGTATGGAAATGGGTTT pLKO.1 1225 CDS 100% 4.050 5.670 N PPARA n/a
6 TRCN0000001668 AGTGGAGCATTGAACATCGAA pLKO.1 514 CDS 100% 3.000 4.200 N PPARA n/a
7 TRCN0000001669 ATATCCACCACTTTAACCTTA pLKO.1 1727 3UTR 100% 4.950 3.960 N PPARA n/a
8 TRCN0000257342 GGAGTTTATGAGGCCATATTC pLKO_005 1165 CDS 100% 13.200 9.240 N PPARA n/a
9 TRCN0000244945 GCGATCTAGAGAGCCCGTTAT pLKO_005 281 CDS 100% 10.800 7.560 N PPARA n/a
10 TRCN0000026026 GCAGAAATTCTTACCTGTGAA pLKO.1 787 CDS 100% 4.950 2.970 N Ppara n/a
11 TRCN0000001665 GAACAGAAACAAATGCCAGTA pLKO.1 675 CDS 100% 4.050 2.430 N PPARA n/a
12 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 2320 3UTR 100% 4.950 2.475 Y ORAI2 n/a
13 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 2408 3UTR 100% 10.800 5.400 Y SMIM11A n/a
14 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 2317 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006724270.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492007 ACGAGGTTAAACTGAGTTGTTTCT pLX_317 26.4% 99.9% 99.7% V5 1404_1405insG n/a
2 TRCN0000488450 TCACCAAAAACACATCGTCTCATC pLX_317 27.7% 99.6% 100% V5 (not translated due to prior stop codon) 1404_1405insTGAGC n/a
3 ccsbBroadEn_11048 pDONR223 100% 53.5% 49.5% None (many diffs) n/a
4 ccsbBroad304_11048 pLX_304 0% 53.5% 49.5% V5 (many diffs) n/a
5 TRCN0000489517 AACCAAAAAGCGTTGCCTAATCGT pLX_317 57.4% 53.5% 49.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV