Transcript: Mouse XM_011245517.2

PREDICTED: Mus musculus peroxisome proliferator activated receptor alpha (Ppara), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppara (19013)
Length:
7642
CDS:
643..2049

Additional Resources:

NCBI RefSeq record:
XM_011245517.2
NBCI Gene record:
Ppara (19013)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245517.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416114 GCACTCTACGTTGCGTTTATA pLKO_005 2335 3UTR 100% 15.000 21.000 N Ppara n/a
2 TRCN0000413243 TGAACATCGAGTGTCGAATAT pLKO_005 935 CDS 100% 13.200 18.480 N Ppara n/a
3 TRCN0000438283 AGACTACCTGCTACCGAAATG pLKO_005 2223 3UTR 100% 10.800 15.120 N Ppara n/a
4 TRCN0000026028 GCTCCTTTGATATGATACTTT pLKO.1 2924 3UTR 100% 5.625 7.875 N Ppara n/a
5 TRCN0000026046 GCTATGAAGTTCAATGCCTTA pLKO.1 1726 CDS 100% 4.050 5.670 N Ppara n/a
6 TRCN0000026041 CCTTCTAAACATAGGCTACAT pLKO.1 1812 CDS 100% 4.950 3.465 N Ppara n/a
7 TRCN0000025967 CCCTTATCTGAAGAATTCTTA pLKO.1 706 CDS 100% 0.000 0.000 N Ppara n/a
8 TRCN0000026026 GCAGAAATTCTTACCTGTGAA pLKO.1 1198 CDS 100% 4.950 2.970 N Ppara n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245517.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492007 ACGAGGTTAAACTGAGTTGTTTCT pLX_317 26.4% 85.4% 92.1% V5 (many diffs) n/a
2 TRCN0000488450 TCACCAAAAACACATCGTCTCATC pLX_317 27.7% 85.2% 92.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_11048 pDONR223 100% 44.6% 45.6% None (many diffs) n/a
4 ccsbBroad304_11048 pLX_304 0% 44.6% 45.6% V5 (many diffs) n/a
5 TRCN0000489517 AACCAAAAAGCGTTGCCTAATCGT pLX_317 57.4% 44.6% 45.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV