Construct: ORF TRCN0000488457
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020573.1_s317c1
- DNA Barcode:
- TGCCTCAGGCCCAATTCCCCTACA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- AK4 (205)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488457
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 205 | AK4 | adenylate kinase 4 | NM_001005353.2 | 100% | 100% | |
| 2 | human | 205 | AK4 | adenylate kinase 4 | NM_013410.4 | 100% | 100% | |
| 3 | human | 205 | AK4 | adenylate kinase 4 | NM_203464.2 | 100% | 100% | |
| 4 | human | 205 | AK4 | adenylate kinase 4 | NM_001330616.2 | 76.6% | 76.6% | 0_1ins156 |
| 5 | human | 205 | AK4 | adenylate kinase 4 | XM_017000613.1 | 76.6% | 76.6% | 0_1ins156 |
| 6 | mouse | 11639 | Ak4 | adenylate kinase 4 | NM_001177602.1 | 87.7% | 90.1% | (many diffs) |
| 7 | mouse | 11639 | Ak4 | adenylate kinase 4 | NM_001177604.1 | 87.7% | 90.1% | (many diffs) |
| 8 | mouse | 11639 | Ak4 | adenylate kinase 4 | NM_001177605.1 | 87.7% | 90.1% | (many diffs) |
| 9 | mouse | 11639 | Ak4 | adenylate kinase 4 | NM_009647.5 | 87.7% | 90.1% | (many diffs) |
| 10 | mouse | 11639 | Ak4 | adenylate kinase 4 | XM_017319923.1 | 72.7% | 75.3% | (many diffs) |
| 11 | mouse | 11639 | Ak4 | adenylate kinase 4 | XM_006502685.3 | 58.2% | 61.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 741
- ORF length:
- 669
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggcttcc aaactcctgc gcgcggtcat cctcgggccg cccggctcgg 121 gcaagggcac cgtgtgccag aggatcgccc agaactttgg tctccagcat ctctccagcg 181 gccacttctt gcgggagaac atcaaggcca gcaccgaagt tggtgagatg gcaaagcagt 241 atatagagaa aagtcttttg gttccagacc atgtgatcac acgcctaatg atgtccgagt 301 tggagaacag gcgtggccag cactggctcc ttgatggttt tcctaggaca ttaggacaag 361 ccgaagccct ggacaaaatc tgtgaagtgg atctagtgat cagtttgaat attccatttg 421 aaacacttaa agatcgtcTC AGCCGCCGTT GGATTCACCC TCCTAGCGGA AGGGTATATA 481 ACCTGGACTT CAATCCACCT CATGTACATG GTATTGATGA CGTCACTGGT GAACCGTTAG 541 TCCAGCAGGA GGATGATAAA CCCGAAGCAG TTGCTGCCAG GCTAAGACAG TACAAAGACG 601 TGGCAAAGCC AGTCATTGAA TTATACAAGA GCCGAGGAGT GCTCCACCAA TTTTCCGGAA 661 CGGAGACGAA CAAAATCTGG CCCTACGTTT ACACACTTTT CTCAAACAAG ATCACACCTA 721 TTCAGTCCAA AGAAGCATAT TGAGACCCAG CTTTCTTGTA CAAAGTGGTT GATATCGGTA 781 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 841 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAT GCCTCAGGCC 901 CAATTCCCCT ACAACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 961 att