Construct: ORF TRCN0000488468
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019353.1_s317c1
- DNA Barcode:
- GTGGCCCTGTAGATGCAACCCCTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CCR3 (1232)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488468
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1232 | CCR3 | C-C motif chemokine receptor 3 | NM_001837.4 | 99.9% | 99.7% | 1065_1066insG |
| 2 | human | 1232 | CCR3 | C-C motif chemokine receptor 3 | NM_178329.3 | 99.9% | 99.7% | 1065_1066insG |
| 3 | human | 1232 | CCR3 | C-C motif chemokine receptor 3 | XM_006712960.3 | 99.9% | 99.7% | 1065_1066insG |
| 4 | human | 1232 | CCR3 | C-C motif chemokine receptor 3 | XM_011533335.2 | 99.9% | 99.7% | 1065_1066insG |
| 5 | human | 1232 | CCR3 | C-C motif chemokine receptor 3 | NM_001164680.2 | 95% | 94.9% | 1_54del;1119_1120insG |
| 6 | human | 1232 | CCR3 | C-C motif chemokine receptor 3 | NM_178328.1 | 94.3% | 94.1% | 1_63del;1128_1129insG |
| 7 | human | 1232 | CCR3 | C-C motif chemokine receptor 3 | XM_017005685.1 | 86.5% | 86.3% | 1_165del;1230_1231insG |
| 8 | human | 1232 | CCR3 | C-C motif chemokine receptor 3 | XM_017005686.1 | 86.5% | 86.3% | 1_165del;1230_1231insG |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1143
- ORF length:
- 1068
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatgaca acctcactag atacagttga gacctttggt accacatcct 121 actatgatga cgtgggcctg ctctgtgaaa aagctgatac cagagcactg atggcccagt 181 ttgtgccccc gctgtactcc ctggtgttca ctgtgggcct cttgggcaat gtggtggtgg 241 tgatgatcct cataaaatac aggaggctcc gaattatgac caacatctac ctgctcaacc 301 tggccatttc ggacctgctc ttcctcgtca cccttccatt ctggatccac tatgtcaggg 361 ggcataactg ggtttttggc catggcatgt gtaagctcct ctcagggttt tatcacacag 421 gcttgtacag cgagatcttt ttcataatcc tgctgacaat cgacaggtac ctggccattg 481 tccatgctgt gtttgccctt cgagcccgga ctgtcacttt tggtgtcatc accagcatcg 541 tcacctgggg cctggcagtg ctagcagctc ttcctgaatt tatcttctat gagactgaag 601 agttgtttga agagactctt tgcagtgctc tttacccaga ggatacagta tatagctgga 661 ggcatttcca cactctgaga atgaccatct tctgtctcgt tctccctctg ctcgttatgg 721 ccatctgcta cacaggaatc atcaaaacgc tgctgaggtg ccccagtaaa aaaaagtaca 781 aggccatccg gctcattttt gtcatcatgg cggtgttttt cattttctgg acacccTACA 841 ATGTGGCTAT CCTTCTCTCT TCCTATCAAT CCATCTTATT TGGAAATGAC TGTGAGCGGA 901 GCAAGCATCT GGACCTGGTC ATGCTGGTGA CAGAGGTGAT CGCCTACTCC CACTGCTGCA 961 TGAACCCGGT GATCTACGCC TTTGTTGGAG AGAGGTTCCG GAAGTACCTG CGCCACTTCT 1021 TCCACAGGCA CTTGCTCATG CACCTGGGCA GATACATCCC ATTCCTTCCT AGTGAGAAGC 1081 TGGAAAGAAC CAGCTCTGTC TCTCCATCCA CAGCAGAGCC GGAACTCTCT ATTGTGTTTG 1141 ACCCAGCTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1201 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1261 TTTATATATC TTGTGGAAAG GACGAGTGGC CCTGTAGATG CAACCCCTGA CGCGTTAAGT 1321 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt