Transcript: Human NM_001164680.2

Homo sapiens C-C motif chemokine receptor 3 (CCR3), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
CCR3 (1232)
Length:
1698
CDS:
97..1218

Additional Resources:

NCBI RefSeq record:
NM_001164680.2
NBCI Gene record:
CCR3 (1232)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001164680.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378237 ATACAGGAGGCTCCGAATTAT pLKO_005 333 CDS 100% 15.000 21.000 N CCR3 n/a
2 TRCN0000008190 GCTCCGAATTATGACCAACAT pLKO.1 342 CDS 100% 4.950 6.930 N CCR3 n/a
3 TRCN0000008189 CGTACTCATCATCAACCCTAA pLKO.1 1419 3UTR 100% 4.050 5.670 N CCR3 n/a
4 TRCN0000356809 CCCAGAGGATACAGTATATAG pLKO_005 711 CDS 100% 13.200 10.560 N CCR3 n/a
5 TRCN0000008191 GCCGGAACTCTCTATTGTGTT pLKO.1 1194 CDS 100% 4.950 3.960 N CCR3 n/a
6 TRCN0000356810 TAGCAGCTCTTCCTGAATTTA pLKO_005 638 CDS 100% 15.000 10.500 N CCR3 n/a
7 TRCN0000356808 CCTTCTCTCTTCCTATCAATC pLKO_005 927 CDS 100% 10.800 7.560 N CCR3 n/a
8 TRCN0000008193 CCCTACAATGTGGCTATCCTT pLKO.1 910 CDS 100% 3.000 2.100 N CCR3 n/a
9 TRCN0000008192 CCACACTCTGAGAATGACCAT pLKO.1 744 CDS 100% 2.640 1.848 N CCR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164680.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00332 pDONR223 100% 95.1% 95.1% None 1_54del n/a
2 ccsbBroad304_00332 pLX_304 0% 95.1% 95.1% V5 1_54del n/a
3 TRCN0000479563 CGAGCGACGGGGTCGCACTCCCCT pLX_317 31.5% 95.1% 95.1% V5 1_54del n/a
4 TRCN0000491439 CGACCAGAAATTGTACTAACTCGG pLX_317 33.8% 95.1% 95.1% V5 (not translated due to prior stop codon) 1_54del n/a
5 TRCN0000488468 GTGGCCCTGTAGATGCAACCCCTG pLX_317 28.7% 95% 94.9% V5 1_54del;1119_1120insG n/a
Download CSV