Construct: ORF TRCN0000488498
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021310.1_s317c1
- DNA Barcode:
- TACTCGACGCGGATATTTTCAAGC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- KCNIP3 (30818)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488498
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 30818 | KCNIP3 | potassium voltage-gated cha... | NM_013434.5 | 100% | 100% | |
| 2 | human | 30818 | KCNIP3 | potassium voltage-gated cha... | NM_001034914.2 | 82.4% | 75.1% | (many diffs) |
| 3 | human | 30818 | KCNIP3 | potassium voltage-gated cha... | XR_922912.1 | 48.7% | 1_114del;560_774del;864_865ins233 | |
| 4 | mouse | 56461 | Kcnip3 | Kv channel interacting prot... | NM_019789.4 | 87.6% | 91.7% | (many diffs) |
| 5 | mouse | 56461 | Kcnip3 | Kv channel interacting prot... | NM_001291005.1 | 78.3% | 70.5% | (many diffs) |
| 6 | mouse | 56461 | Kcnip3 | Kv channel interacting prot... | XM_011239710.2 | 77.2% | 74.4% | (many diffs) |
| 7 | mouse | 56461 | Kcnip3 | Kv channel interacting prot... | NM_001111331.1 | 74.4% | 72.9% | (many diffs) |
| 8 | mouse | 56461 | Kcnip3 | Kv channel interacting prot... | NR_110989.1 | 22.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 840
- ORF length:
- 768
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgcagccg gctaaggaag tgacaaaggc gtcggacggc agcctcctgg 121 gggacctcgg gcacacacca cttagcaaga aggagggtat caagtggcag aggccgaggc 181 tcagccgcca ggctttgatg agatgctgcc tggtcaagtg gatcctgtcc agcacagccc 241 cacagggctc agatagcagc gacagtgagc tggagctgtc cacggtgcgc caccagccag 301 aggggctgga ccagctgcag gcccagacca agttcaccaa gaaggagctg cagtctctct 361 acaggggctt taagaatgag tgtcccacgg gcctggtgga cgaagacacc ttcaaactca 421 tttacgcgca gttcttccct cagggagatg ccaccaccta tgcacacttc ctcttcaacg 481 cctttgatgc ggacgggaac ggggccatcc acttTGAGGA CTTTGTGGTT GGCCTCTCCA 541 TCCTGCTGCG GGGCACAGTC CACGAGAAGC TCAAGTGGGC CTTTAATCTC TACGACATTA 601 ACAAGGATGG CTACATCACC AAAGAGGAGA TGCTGGCCAT CATGAAGTCC ATCTATGACA 661 TGATGGGCCG CCACACCTAC CCCATCCTGC GGGAGGACGC GCCGGCGGAG CACGTGGAGA 721 GGTTCTTCGA GAAAATGGAC CGGAACCAGG ATGGGGTAGT GACCATTGAA GAGTTCCTGG 781 AGGCCTGTCA GAAGGATGAG AACATCATGA GCTCCATGCA GCTGTTTGAG AATGTCATCT 841 AGAACCCAGC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 901 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 961 GGCTTTATAT ATCTTGTGGA AAGGACGATA CTCGACGCGG ATATTTTCAA GCACGCGTTA 1021 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt