Transcript: Human NM_001034914.2

Homo sapiens potassium voltage-gated channel interacting protein 3 (KCNIP3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
KCNIP3 (30818)
Length:
3083
CDS:
363..1055

Additional Resources:

NCBI RefSeq record:
NM_001034914.2
NBCI Gene record:
KCNIP3 (30818)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001034914.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017598 GCCTTTAATCTCTACGACATT pLKO.1 792 CDS 100% 4.950 6.930 N KCNIP3 n/a
2 TRCN0000017599 CAAACTCATTTACGCGCAGTT pLKO.1 626 CDS 100% 4.050 5.670 N KCNIP3 n/a
3 TRCN0000086202 AGACACCTTCAAACTCATTTA pLKO.1 617 CDS 100% 13.200 9.240 N Kcnip3 n/a
4 TRCN0000442186 GGCCTGTCAGAAGGATGAGAA pLKO_005 995 CDS 100% 4.950 3.465 N KCNIP3 n/a
5 TRCN0000017601 GTGGAGAGGTTCTTCGAGAAA pLKO.1 927 CDS 100% 4.950 3.465 N KCNIP3 n/a
6 TRCN0000017602 GCTTTAAGAATGAGTGTCCCA pLKO.1 580 CDS 100% 0.660 0.462 N KCNIP3 n/a
7 TRCN0000086200 GACACCTTCAAACTCATTTAT pLKO.1 618 CDS 100% 15.000 10.500 N Kcnip3 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1177 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001034914.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488498 TACTCGACGCGGATATTTTCAAGC pLX_317 42.5% 82.4% 75.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV