Construct: ORF TRCN0000488504
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020791.1_s317c1
- DNA Barcode:
- AGTCAATCGTTTACCATTGTGTTG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- GPRC5B (51704)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488504
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51704 | GPRC5B | G protein-coupled receptor ... | NM_016235.3 | 100% | 100% | |
| 2 | human | 51704 | GPRC5B | G protein-coupled receptor ... | XM_006721051.3 | 100% | 100% | |
| 3 | human | 51704 | GPRC5B | G protein-coupled receptor ... | XM_006721052.2 | 100% | 100% | |
| 4 | human | 51704 | GPRC5B | G protein-coupled receptor ... | NM_001304771.1 | 75.4% | 75.4% | 1_393del |
| 5 | mouse | 64297 | Gprc5b | G protein-coupled receptor,... | NM_022420.2 | 84.8% | 85.6% | (many diffs) |
| 6 | mouse | 64297 | Gprc5b | G protein-coupled receptor,... | NM_001195774.1 | 82.1% | 82.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1281
- ORF length:
- 1209
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgttcgtg gcatcagaga gaaagatgag agctcaccag gtgctcacct 121 tcctcctgct cttcgtgatc acctcggtgg cctctgaaaa cgccagcaca tcccgaggct 181 gtgggctgga cctcctccct cagtacgtgt ccctgtgcga cctggacgcc atctggggca 241 ttgtggtgga ggcggtggcc ggggcgggcg ccctgatcac actgctcctg atgctcatcc 301 tcctggtgcg gctgcccttc atcaaggaga aggagaagaa gagccctgtg ggcctccact 361 ttctgttcct cctggggacc ctgggcctct ttgggctgac gtttgccttc atcatccagg 421 aggacgagac catctgctct gtccgccgct tcctctgggg cgtcctcttt gcgctctgct 481 tctcctgcct gctgagccag gcatggcgcg tgcggaggct ggtgcggcat ggcacgggcc 541 ccgcgggctg gcagctggtg ggcctggcgc tgtgcctgat gctggtgcaa gtcatcatcg 601 ctgtggagtg gctggtgctc accgtgctgc gtgacacaag gccagcctgc gcctacgagc 661 ccatggactt tgtgatggcc ctcatctacg acatggtact gcttgtggtc accctggggc 721 tggccctctt cactctgtgc ggcaagttca agaggtggaa gctgaacggg gccttcctcc 781 tcatcacagc cttcctctct gtgctcatct gggtggcctg gatgaccatg tacctcttcg 841 gcaatgtcaa gctgcagcag ggggatgcct ggaacgaccc caccttggcc atcacgctgg 901 cggccagcgg ctgggtcttc gtcatcttcc acgccatccc tgagatccac tgcacccttc 961 tgccagcccT GCAGGAGAAC ACGCCCAACT ACTTCGACAC GTCGCAGCCC AGGATGCGGG 1021 AGACGGCCTT CGAGGAGGAC GTGCAGCTGC CGCGGGCCTA TATGGAGAAC AAGGCCTTCT 1081 CCATGGATGA ACACAATGCA GCTCTCCGAA CAGCAGGATT TCCCAACGGC AGCTTGGGAA 1141 AAAGACCCAG TGGCAGCTTG GGGAAAAGAC CCAGCGCTCC GTTTAGAAGC AACGTGTATC 1201 AGCCAACTGA GATGGCCGTC GTGCTCAACG GTGGGACCAT CCCAACTGCT CCGCCAAGTC 1261 ACACAGGAAG ACACCTTTGG TAGGACCCAG CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1321 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1381 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA GTCAATCGTT 1441 TACCATTGTG TTGACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1501 att