Transcript: Human NM_016235.3

Homo sapiens G protein-coupled receptor class C group 5 member B (GPRC5B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
GPRC5B (51704)
Length:
5144
CDS:
124..1335

Additional Resources:

NCBI RefSeq record:
NM_016235.3
NBCI Gene record:
GPRC5B (51704)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016235.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367723 ACCGTTGCGTTGAGGACAAAT pLKO_005 1783 3UTR 100% 13.200 18.480 N GPRC5B n/a
2 TRCN0000357402 CGTTTAGAAGCAACGTGTATC pLKO_005 1232 CDS 100% 10.800 15.120 N GPRC5B n/a
3 TRCN0000008983 CCGTTTAGAAGCAACGTGTAT pLKO.1 1231 CDS 100% 4.950 6.930 N GPRC5B n/a
4 TRCN0000008982 CGCAAACTAAAGCAAAGCTAA pLKO.1 1581 3UTR 100% 4.950 3.960 N GPRC5B n/a
5 TRCN0000378377 ACCTTTGGTGAAAGACTTTAA pLKO_005 1325 CDS 100% 13.200 9.240 N GPRC5B n/a
6 TRCN0000378296 AGAATTTCTCTTACCGATTTG pLKO_005 1359 3UTR 100% 10.800 7.560 N GPRC5B n/a
7 TRCN0000008984 GCTGACGTTTGCCTTCATCAT pLKO.1 447 CDS 100% 4.950 3.465 N GPRC5B n/a
8 TRCN0000008985 ACCATGTACCTCTTCGGCAAT pLKO.1 877 CDS 100% 4.050 2.835 N GPRC5B n/a
9 TRCN0000008986 GCCCTCATCTACGACATGGTA pLKO.1 730 CDS 100% 3.000 2.100 N GPRC5B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016235.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03368 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03368 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473517 ACTTGCAAGCTACGAAACAAAGAC pLX_317 38.4% 100% 100% V5 n/a
4 TRCN0000488504 AGTCAATCGTTTACCATTGTGTTG pLX_317 26.2% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV