Construct: ORF TRCN0000488536
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020388.1_s317c1
- DNA Barcode:
- TGGCAAGATATCCTGAGACTAGCT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- CHUK (1147)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488536
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1147 | CHUK | component of inhibitor of n... | NM_001278.5 | 100% | 100% | |
| 2 | human | 1147 | CHUK | component of inhibitor of n... | NM_001320928.1 | 96.5% | 93.7% | 2090_2091insGGTAACTCCTCAAGATG;2157_2158ins61 |
| 3 | human | 1147 | CHUK | component of inhibitor of n... | XM_017015611.1 | 91.2% | 90.6% | (many diffs) |
| 4 | human | 1147 | CHUK | component of inhibitor of n... | XM_017015612.1 | 79.1% | 77.7% | (many diffs) |
| 5 | human | 1147 | CHUK | component of inhibitor of n... | XR_001747011.1 | 60% | 1_78del;1206_1207ins103;2211_3445del | |
| 6 | human | 1147 | CHUK | component of inhibitor of n... | XR_001747010.1 | 59.3% | 1_78del;2186_2420del;2549_3764del | |
| 7 | human | 1147 | CHUK | component of inhibitor of n... | XM_017015613.1 | 41.6% | 40.2% | (many diffs) |
| 8 | mouse | 12675 | Chuk | conserved helix-loop-helix ... | NM_007700.2 | 92.4% | 95.3% | (many diffs) |
| 9 | mouse | 12675 | Chuk | conserved helix-loop-helix ... | NM_001162410.1 | 89.3% | 90.1% | (many diffs) |
| 10 | mouse | 12675 | Chuk | conserved helix-loop-helix ... | XM_011247129.2 | 86.3% | 88.3% | (many diffs) |
| 11 | mouse | 12675 | Chuk | conserved helix-loop-helix ... | XR_001782558.1 | 65.8% | (many diffs) | |
| 12 | mouse | 12675 | Chuk | conserved helix-loop-helix ... | XR_001782557.1 | 32.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 2307
- ORF length:
- 2235
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggagcgg cccccggggc tgcggccggg cgcgggcggg ccctgggaga 121 tgcgggagcg gctgggcacc ggcggcttcg ggaacgtctg tctgtaccag catcgggaac 181 ttgatctcaa aatagcaatt aagtcttgtc gcctagagct aagtaccaaa aacagagaac 241 gatggtgcca tgaaatccag attatgaaga agttgaacca tgccaatgtt gtaaaggcct 301 gtgatgttcc tgaagaattg aatattttga ttcatgatgt gcctcttcta gcaatggaat 361 actgttctgg aggagatctc cgaaagctgc tcaacaaacc agaaaattgt tgtggactta 421 aagaaagcca gatactttct ttactaagtg atatagggtc tgggattcga tatttgcatg 481 aaaacaaaat tatacatcga gatctaaaac ctgaaaacat agttcttcag gatgttggtg 541 gaaagataat acataaaata attgatctgg gatatgccaa agatgttgat caaggaagtc 601 tgtgtacatc ttttgtggga acactgcagt atctggcccc agagctcttt gagaataagc 661 cttacacagc cactgttgat tattggagct ttgggaccat ggtatttgaa tgtattgctg 721 gatataggcc ttttttgcat catctgcagc catttacctg gcatgagaag attaagaaga 781 aggatccaaa gtgtatattt gcatgtgaag agatgtcagg agaagttcgg tttagtagcc 841 atttacctca accaaatagc ctttgtagtt tagtagtaga acccatggaa aactggctac 901 agttgatgtt gaattgggac cctcagcaga gaggaggacc tgttgacctt actttgaagc 961 agccaagatg ttttgtatta atggatcaca ttttgaattt gaagatagta cacatcctaa 1021 atatgacttc tgcaaagata atttcttttc tgttaccacc tgatgaaagt cttcattcac 1081 tacagtctcg tattgagcgt gaaactggaa taaatactgg ttctcaagaa cttctttcag 1141 agacaggaat ttctctggat cctcggaaac cagcctctca atgtgttcta gatggagtta 1201 gaggctgtga tagctatatg gtttatttgt ttgataaaag taaaactgta tatgaagggc 1261 catttgcttc cagaagttta tctgattgtg taaattatat tgtacaggac agcaaaatac 1321 agcttccaat tatacagctg cgtaaagtgt gggctgaagc agtgcactat gtgtctggac 1381 taaaagaaga ctatagcagg ctctttcagg gacaaagggc agcaatgtta agtcttctta 1441 gatataatgc taacttaaca aaaatgaaga acactttgat ctcagcatca caacaactga 1501 aagctaaatt ggagtttttt cacaaaagca ttcagcttga cttggagaga tacagcgagc 1561 agatgacgta tgggatatct tcagaaaaaa tgctaaaagc atggaaagaa atggaagaaa 1621 aggccatcca ctatgctgag gttggtgtca ttggatacct ggaggatcag attatgtctt 1681 tgcatgctga aatcatggag ctacagaaga gcccctatgg aagacgtcag ggagacttga 1741 tggaatctct ggaacagcgt gccattgatc tatataagca gttaaaacac agaccttcag 1801 atcactccta cagtgacagc acagagatgg tgaaaatcat tgtgcacact gtgcagagtc 1861 aggaccgtgt gctcaaggag ctgtttggtc atttgagcaa gttgttgggc tgtaagcaga 1921 agattattga tctactccct aaggtggaag tggcccTCAG TAATATCAAA GAAGCTGACA 1981 ATACTGTCAT GTTCATGCAG GGAAAAAGGC AGAAAGAAAT ATGGCATCTC CTTAAAATTG 2041 CCTGTACACA GAGTTCTGCC CGGTCCCTTG TAGGATCCAG TCTAGAAGGT GCAGTAACCC 2101 CTCAGACATC AGCATGGCTG CCCCCGACTT CAGCAGAACA TGATCATTCT CTGTCATGTG 2161 TGGTAACTCC TCAAGATGGG GAGACTTCAG CACAAATGAT AGAAGAAAAT TTGAACTGCC 2221 TTGGCCATTT AAGCACTATT ATTCATGAGG CAAATGAGGA ACAGGGCAAT AGTATGATGA 2281 ATCTTGATTG GAGTTGGTTA ACAGAATAGG ACCCAGCTTT CTTGTACAAA GTGGTTGATA 2341 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 2401 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGATGGCA 2461 AGATATCCTG AGACTAGCTA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 2521 tgaaagatt