Transcript: Human XR_001747010.1

PREDICTED: Homo sapiens component of inhibitor of nuclear factor kappa B kinase complex (CHUK), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHUK (1147)
Length:
3764
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001747010.1
NBCI Gene record:
CHUK (1147)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001747010.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244902 ACAGCGTGCCATTGATCTATA pLKO_005 1761 3UTR 100% 13.200 18.480 N CHUK n/a
2 TRCN0000196924 GCTGCTCACAAGTTCTATTTC pLKO.1 3011 3UTR 100% 13.200 18.480 N CHUK n/a
3 TRCN0000244904 GGTTAATGTAGTATGGTATAT pLKO_005 3570 3UTR 100% 13.200 18.480 N CHUK n/a
4 TRCN0000219675 TAGGGTCTGGGATTCGATATT pLKO.1 461 3UTR 100% 13.200 18.480 N CHUK n/a
5 TRCN0000244900 TAGGGTCTGGGATTCGATATT pLKO_005 461 3UTR 100% 13.200 18.480 N CHUK n/a
6 TRCN0000199496 GCAGATGACGTATGGGATATC pLKO.1 1566 3UTR 100% 10.800 15.120 N CHUK n/a
7 TRCN0000000504 GCATCATAAGGAGTTGGTGTA pLKO.1 3084 3UTR 100% 4.050 5.670 N CHUK n/a
8 TRCN0000000508 GCGTGCCATTGATCTATATAA pLKO.1 1764 3UTR 100% 15.000 10.500 N CHUK n/a
9 TRCN0000219676 TGGCCATTTAAGCACTATTAT pLKO.1 2464 3UTR 100% 15.000 10.500 N CHUK n/a
10 TRCN0000244903 TGGCCATTTAAGCACTATTAT pLKO_005 2464 3UTR 100% 15.000 10.500 N CHUK n/a
11 TRCN0000244901 TGAATGTATTGCTGGATATAG pLKO_005 714 3UTR 100% 13.200 9.240 N CHUK n/a
12 TRCN0000194782 CCAGATACTTTCTTTACTAAG pLKO.1 435 3UTR 100% 10.800 7.560 N CHUK n/a
13 TRCN0000000505 CCAGATTATGAAGAAGTTGAA pLKO.1 264 3UTR 100% 4.950 3.465 N CHUK n/a
14 TRCN0000000506 CCAGCCTCTCAATGTGTTCTA pLKO.1 1177 3UTR 100% 4.950 3.465 N CHUK n/a
15 TRCN0000012349 CCTAAATATGACTTCTGCAAA pLKO.1 1023 3UTR 100% 4.950 3.465 N Chuk n/a
16 TRCN0000012350 GCAGCAATGTTAAGTCTTCTT pLKO.1 1426 3UTR 100% 4.950 3.465 N Chuk n/a
17 TRCN0000280138 GCAGCAATGTTAAGTCTTCTT pLKO_005 1426 3UTR 100% 4.950 3.465 N Chuk n/a
18 TRCN0000000507 GCAAATGAGGAACAGGGCAAT pLKO.1 2492 3UTR 100% 4.050 2.835 N CHUK n/a
19 TRCN0000012351 GCTGACAATACTGTCATGTTT pLKO.1 1981 3UTR 100% 0.563 0.394 N Chuk n/a
20 TRCN0000280139 GCTGACAATACTGTCATGTTT pLKO_005 1981 3UTR 100% 0.563 0.394 N Chuk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001747010.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489445 CATGAACCATAATCTGTGACGGGA pLX_317 16% 59.3% V5 1_78del;2186_2420del;2549_3764delinsG n/a
2 TRCN0000488536 TGGCAAGATATCCTGAGACTAGCT pLX_317 16% 59.3% V5 (not translated due to prior stop codon) 1_78del;2186_2420del;2549_3764del n/a
Download CSV