Construct: ORF TRCN0000488577
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020351.1_s317c1
- DNA Barcode:
- CAGGGATGGGGACCTGCTCTTTAT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- PIP4K2C (79837)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488577
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 79837 | PIP4K2C | phosphatidylinositol-5-phos... | XM_017019973.2 | 88.3% | 88.4% | 1_87del;633T>C |
| 2 | human | 79837 | PIP4K2C | phosphatidylinositol-5-phos... | NM_001146260.2 | 59.4% | 59.5% | 1_453del;999T>C |
| 3 | human | 79837 | PIP4K2C | phosphatidylinositol-5-phos... | NM_001146259.2 | 55% | 55% | 1_543del;1089T>C |
| 4 | human | 79837 | PIP4K2C | phosphatidylinositol-5-phos... | NM_001146258.2 | 52.6% | 52.7% | 1_597del;1143T>C |
| 5 | human | 79837 | PIP4K2C | phosphatidylinositol-5-phos... | NM_024779.5 | 52.6% | 52.7% | 1_597del;1143T>C |
| 6 | human | 79837 | PIP4K2C | phosphatidylinositol-5-phos... | XM_005269152.3 | 49.5% | 49.6% | 1_597del;657_658ins39;1104T>C |
| 7 | mouse | 117150 | Pip4k2c | phosphatidylinositol-5-phos... | NM_054097.3 | 48.2% | 51% | (many diffs) |
| 8 | mouse | 117150 | Pip4k2c | phosphatidylinositol-5-phos... | XM_017313768.1 | 48.2% | 51% | (many diffs) |
| 9 | mouse | 117150 | Pip4k2c | phosphatidylinositol-5-phos... | XM_011243289.2 | 42.5% | 44.3% | (many diffs) |
| 10 | mouse | 117150 | Pip4k2c | phosphatidylinositol-5-phos... | XM_006513120.2 | 42.3% | 44.8% | (many diffs) |
| 11 | mouse | 117150 | Pip4k2c | phosphatidylinositol-5-phos... | XM_006513121.3 | 42.3% | 44.8% | (many diffs) |
| 12 | mouse | 117150 | Pip4k2c | phosphatidylinositol-5-phos... | XM_011243288.2 | 37.5% | 39.1% | (many diffs) |
| 13 | mouse | 117150 | Pip4k2c | phosphatidylinositol-5-phos... | XR_871695.2 | 18.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 738
- ORF length:
- 666
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgcttgtg atgcgcaata tgtttagcca ccgtcttcct gtgcacagga 121 agtatgacct caagggttcc ctagtgtccc gggaagccag cgataaggaa aaggttaaag 181 aattgcccac ccttaaggat atggactttc tcaacaagaa ccagaaagta tatattggtg 241 aagaggagaa gaaaatattt ctggagaagc tgaagagaga tgtggagttt ctagtgcagc 301 tgaagatcat ggactacagc cttctgctag gcatccacga catcattcgg ggctctgaac 361 cagaggagga agcgcccgtg cgggaggatg agtcagaggt ggatggggac tgcagcctga 421 ctggacctcc tgctctggtg ggctcctatg gcacctcccC AGAGGGTATC GGAGGCTACA 481 TCCATTCCCA TCGGCCCCTG GGCCCAGGAG AGTTTGAGTC CTTCATTGAT GTCTATGCCA 541 TCCGGAGTGC TGAAGGAGCC CCCCAGAAGG AGGTCTACTT CATGGGCCTC ATTGATATCC 601 TTACACAGTA TGATGCCAAG AAGAAAGCAG CTCATGCAGC CAAAACTGTC AAGCATGGGG 661 CTGGGGCAGA GATCTCTACT GTCCATCCGG AGCAGTATGC TAAGCGATTC CTGGATTTTA 721 TTACCAACAT CTTTGCCTGA GACCCAGCTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 781 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 841 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGACAGG GATGGGGACC 901 TGCTCTTTAT ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt