Transcript: Mouse XM_011243289.2

PREDICTED: Mus musculus phosphatidylinositol-5-phosphate 4-kinase, type II, gamma (Pip4k2c), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pip4k2c (117150)
Length:
3433
CDS:
107..1387

Additional Resources:

NCBI RefSeq record:
XM_011243289.2
NBCI Gene record:
Pip4k2c (117150)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243289.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024702 CTCCAAGATCAAGGTCAACAA pLKO.1 343 CDS 100% 4.950 3.465 N Pip4k2c n/a
2 TRCN0000319779 CTCCAAGATCAAGGTCAACAA pLKO_005 343 CDS 100% 4.950 3.465 N Pip4k2c n/a
3 TRCN0000024703 GAGTCCTTCATCGATGTCTAT pLKO.1 1148 CDS 100% 4.950 3.465 N Pip4k2c n/a
4 TRCN0000319782 GAGTCCTTCATCGATGTCTAT pLKO_005 1148 CDS 100% 4.950 3.465 N Pip4k2c n/a
5 TRCN0000024699 CGAGCGAAGATATTGCGGATA pLKO.1 570 CDS 100% 4.050 2.835 N Pip4k2c n/a
6 TRCN0000319780 CGAGCGAAGATATTGCGGATA pLKO_005 570 CDS 100% 4.050 2.835 N Pip4k2c n/a
7 TRCN0000024701 GCATAGGAAGTATGACCTCAA pLKO.1 745 CDS 100% 4.050 2.835 N Pip4k2c n/a
8 TRCN0000319781 GCATAGGAAGTATGACCTCAA pLKO_005 745 CDS 100% 4.050 2.835 N Pip4k2c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243289.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15154 pDONR223 100% 81.1% 57.3% None (many diffs) n/a
2 ccsbBroad304_15154 pLX_304 0% 81.1% 57.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000466306 CTAATCTCCCGAAAGCCTCATTGA pLX_317 24.6% 81.1% 57.3% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000488577 CAGGGATGGGGACCTGCTCTTTAT pLX_317 42% 42.5% 44.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV