Construct: ORF TRCN0000488597
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021504.1_s317c1
- DNA Barcode:
- AGTGATGCTCCCCTCTCAGTTGCC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- PPIE (10450)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488597
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10450 | PPIE | peptidylprolyl isomerase E | NM_006112.4 | 100% | 100% | |
| 2 | human | 10450 | PPIE | peptidylprolyl isomerase E | XM_006710290.4 | 95.6% | 95.6% | 382_383ins39 |
| 3 | human | 10450 | PPIE | peptidylprolyl isomerase E | NM_203456.2 | 95.3% | 92.7% | (many diffs) |
| 4 | human | 10450 | PPIE | peptidylprolyl isomerase E | NM_001195007.1 | 91.5% | 89.7% | (many diffs) |
| 5 | human | 10450 | PPIE | peptidylprolyl isomerase E | XM_017000051.2 | 91.5% | 89.7% | (many diffs) |
| 6 | human | 10450 | PPIE | peptidylprolyl isomerase E | NM_001319293.1 | 91.1% | 88.4% | (many diffs) |
| 7 | human | 10450 | PPIE | peptidylprolyl isomerase E | XM_006710289.3 | 87.5% | 85.7% | (many diffs) |
| 8 | human | 10450 | PPIE | peptidylprolyl isomerase E | XM_017000052.1 | 72% | 72% | 0_1ins252 |
| 9 | human | 10450 | PPIE | peptidylprolyl isomerase E | XM_024450264.1 | 72% | 72% | 0_1ins252 |
| 10 | human | 10450 | PPIE | peptidylprolyl isomerase E | XM_024450277.1 | 67.7% | 65% | (many diffs) |
| 11 | human | 10450 | PPIE | peptidylprolyl isomerase E | XM_011540501.1 | 65.3% | 63.6% | (many diffs) |
| 12 | human | 10450 | PPIE | peptidylprolyl isomerase E | XM_024450252.1 | 65.3% | 63.6% | (many diffs) |
| 13 | human | 10450 | PPIE | peptidylprolyl isomerase E | XR_946520.3 | 60.6% | (many diffs) | |
| 14 | human | 10450 | PPIE | peptidylprolyl isomerase E | XR_946519.3 | 60.5% | 1_29del;411_412ins124;809_1162del | |
| 15 | human | 10450 | PPIE | peptidylprolyl isomerase E | XR_946521.3 | 26.3% | (many diffs) | |
| 16 | human | 10450 | PPIE | peptidylprolyl isomerase E | NR_036543.1 | 20.3% | 1_56del;79_80insGTACGTGG;952_4384del | |
| 17 | human | 10450 | PPIE | peptidylprolyl isomerase E | NR_036544.1 | 19.4% | (many diffs) | |
| 18 | mouse | 56031 | Ppie | peptidylprolyl isomerase E ... | NM_019489.5 | 90.9% | 98.3% | (many diffs) |
| 19 | mouse | 56031 | Ppie | peptidylprolyl isomerase E ... | XM_006503249.3 | 70.9% | 76.4% | (many diffs) |
| 20 | mouse | 56031 | Ppie | peptidylprolyl isomerase E ... | XM_006503250.3 | 65.4% | 70.4% | (many diffs) |
| 21 | mouse | 56031 | Ppie | peptidylprolyl isomerase E ... | XM_011240581.1 | 65.4% | 70.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 972
- ORF length:
- 903
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat ggccaccacc aagcgcgtct tgtacgtggg tggactggca gaggaagtgg 121 acgacaaagt tcttcatgct gcgttcattc cttttggaga catcacagat attcagattc 181 ctctggatta tgaaacagaa aagcaccgag gatttgcttt tgttgaattt gagttggcag 241 aggatgctgc agcagctatc gacaacatga atgaatctga gctttttgga cgtacaattc 301 gtgtcaattt ggccaaacca atgagaatta aggaaggctc ttccaggcca gtttggtcag 361 atgatgactg gttgaagaag ttttctggga agacgcttga agagaataaa gaggaagaag 421 ggtcagagcc tcccaaagca gagacccagg agggagagcc cattgctaaa aaggcccgct 481 caaatcctca ggtgtacatg gacatcaaga ttgggaacaa gccggctggc cgcatccaga 541 tgctcctgcg ttctgatgtc gtgcccatga cagcagagaa tttccgctgc ctgtgcactc 601 atgaaaaggg ctttggcttt aagggaagca gcttccaccg caTCATCCCC CAGTTCATGT 661 GCCAGGGCGG TGATTTCACA AACCACAATG GCACTGGGGG CAAGTCCATC TATGGGAAGA 721 AGTTCGATGA TGAAAACTTT ATCCTCAAGC ATACGGGACC AGGTCTACTA TCCATGGCCA 781 ACTCTGGCCC AAACACCAAT GGCTCTCAGT TCTTCCTGAC ATGTGACAAG ACAGACTGGC 841 TGGATGGCAA GCATGTGGTG TTTGGAGAGG TCACCGAAGG CCTAGATGTC TTGCGGCAAA 901 TTGAGGCCCA GGGCAGCAAG GACGGGAAGC CAAAGCAGAA GGTGATCATC GCCGACTGTG 961 GGGAGTACGT GTAGAACCCA GCTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1021 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1081 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA AGTGATGCTC CCCTCTCAGT 1141 TGCCACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt