Construct: ORF TRCN0000488646
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019239.1_s317c1
- DNA Barcode:
- CTCAATCCTGCACAAGAGCCAGTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GALR2 (8811)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488646
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8811 | GALR2 | galanin receptor 2 | NM_003857.4 | 100% | 100% | |
| 2 | human | 8811 | GALR2 | galanin receptor 2 | XM_011525427.3 | 79.5% | 74.3% | (many diffs) |
| 3 | mouse | 14428 | Galr2 | galanin receptor 2 | NM_010254.4 | 81.2% | 80.9% | (many diffs) |
| 4 | mouse | 14428 | Galr2 | galanin receptor 2 | XM_011248727.2 | 80.3% | 80.1% | (many diffs) |
| 5 | mouse | 14428 | Galr2 | galanin receptor 2 | XM_011248728.2 | 80.2% | 80.1% | (many diffs) |
| 6 | mouse | 14428 | Galr2 | galanin receptor 2 | XM_011248729.2 | 76.9% | 78.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1236
- ORF length:
- 1161
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatgaac gtctcgggct gcccaggggc cgggaacgcg agccaggcgg 121 gcggcggggg aggctggcac cccgaggcgg tcatcgtgcc cctgctcttc gcgctcatct 181 tcctcgtggg caccgtgggc aacacgctgg tgctggcggt gctgctgcgc ggcggccagg 241 cggtcagcac taccaacctg ttcatcctta acctgggcgt ggccgacctg tgtttcatcc 301 tgtgctgcgt gcccttccag gccaccatct acaccctgga cggctgggtg ttcggctcgc 361 tgctgtgcaa ggcggtgcac ttcctcatct tcctcaccat gcacgccagc agcttcacgc 421 tggccgccgt ctccctggac aggtatctgg ccatccgcta cccgctgcac tcccgcgagc 481 tgcgcacgcc tcgaaacgcg ctggcagcca tcgggctcat ctgggggctg tcgctgctct 541 tctccgggcc ctacctgagc tactaccgcc agtcgcagct ggccaacctg accgtgtgcc 601 atcccgcgtg gagcgcccct cgccgccgcg ccatggacat ctgcaccttc gtcttcagct 661 acctgcttcc tgtgctggtt ctcggcctga cctacgcgcg caccttgcgc tacctctggc 721 gcgccgtcga cccggtggcc gcgggctcgg gtgcccggcg cgccaagcgc aaggtgacac 781 gcatgatcct catcgtggcc gcgctcttct gcctctgctg gatgccccac cacgcgctca 841 tcctctgcgt gtggttcggc cagttcccgc tcacgcgcgc cacttatgcg cttcgcatcc 901 tctcgcacct ggtctcctac gccaactccT GCGTCAACCC CATCGTTTAC GCGCTGGTCT 961 CCAAGCACTT CCGCAAAGGC TTCCGCACGA TCTGCGCGGG CCTGCTGGGC CGTGCCCCAG 1021 GCCGAGCCTC GGGCCGTGTG TGCGCTGCCG CGCGGGGCAC CCACAGTGGC AGCGTGTTGG 1081 AGCGCGAGTC CAGCGACCTG TTGCACATGA GCGAGGCGGC GGGGGCCCTT CGTCCCTGCC 1141 CCGGCGCTTC CCAGCCATGC ATCCTCGAGC CCTGTCCTGG CCCGTCCTGG CAGGGCCCAA 1201 AGGCAGGCGA CAGCATCCTG ACGGTTGATG TGGCCGACCC AGCTTTCTTG TACAAAGTGG 1261 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1321 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1381 ACTCAATCCT GCACAAGAGC CAGTAACGCG TTAAGTCgac aatcaacctc tggattacaa 1441 aatttgtgaa agatt