Construct: ORF TRCN0000488653
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019694.1_s317c1
- DNA Barcode:
- TCTCACCTCTCGCATGTTCCAAAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CAMK1 (8536)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488653
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8536 | CAMK1 | calcium/calmodulin dependen... | NM_003656.5 | 99.9% | 99.7% | 1110_1111insG |
| 2 | human | 8536 | CAMK1 | calcium/calmodulin dependen... | XM_005265516.2 | 89.5% | 84.7% | 1030_1136del;1218_1239delinsG |
| 3 | human | 8536 | CAMK1 | calcium/calmodulin dependen... | XM_017007354.1 | 88% | 87.8% | 83_84ins132;978_979insG |
| 4 | human | 8536 | CAMK1 | calcium/calmodulin dependen... | XM_024453796.1 | 83.1% | 83% | 0_1ins186;924_925insG |
| 5 | human | 8536 | CAMK1 | calcium/calmodulin dependen... | XM_005265517.3 | 78.9% | 74% | 83_84ins132;898_1004del;1086_1107delinsG |
| 6 | human | 8536 | CAMK1 | calcium/calmodulin dependen... | XR_940505.2 | 68.9% | 1_139del;771_772ins113;1137_1333delinsG | |
| 7 | mouse | 52163 | Camk1 | calcium/calmodulin-dependen... | NM_133926.2 | 89.8% | 96.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1188
- ORF length:
- 1113
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatgctg ggggcagtgg aaggccccag gtggaagcag gcggaggaca 121 ttagagacat ctacgacttc cgagatgttc tgggcacggg ggccttctcg gaggtgatcc 181 tggcagaaga taagaggacg cagaagctgg tggccatcaa atgcattgcc aaggaggccc 241 tggagggcaa ggaaggcagc atggagaatg agattgctgt cctgcacaag atcaagcacc 301 ccaacattgt agccctggat gacatctatg agagtggggg ccacctctac ctcatcatgc 361 agctggtgtc gggtggggag ctctttgacc gtattgtgga aaaaggcttc tacacggagc 421 gggacgccag ccgcctcatc ttccaggtgc tggatgctgt gaaatacctg catgacctgg 481 gcattgtaca ccgggatctc aagccagaga atctgctgta ctacagcctg gatgaagact 541 ccaaaatcat gatctccgac tttggcctct ccaagatgga ggacccgggc agtgtgctct 601 ccaccgcctg tggaactccg ggatacgtgg cccctgaagt cctggcccag aagccctaca 661 gcaaggctgt ggattgctgg tccataggtg tcatcgccta catcttgctc tgcggttacc 721 ctcccttcta tgacgagaat gatgccaaac tctttgaaca gattttgaag gccgagtacg 781 agtttgactc tccttactgg gacgacatct ctgactctgc caaagatttc atccggcact 841 tgatgGAGAA GGACCCAGAG AAAAGATTCA CCTGTGAGCA GGCCTTGCAG CACCCATGGA 901 TTGCAGGAGA TACAGCTCTA GATAAGAATA TCCACCAGTC GGTGAGTGAG CAGATCAAGA 961 AGAACTTTGC CAAGAGCAAG TGGAAGCAAG CCTTCAATGC CACGGCTGTG GTGCGGCACA 1021 TGAGGAAACT GCAGCTGGGC ACCAGCCAGG AGGGGCAGGG GCAGACGGCG AGCCATGGGG 1081 AGCTGCTGAC ACCAGTGGCT GGGGGGCCGG CAGCTGGCTG TTGCTGTCGA GACTGCTGCG 1141 TGGAGCCGGG CACAGAACTG TCCCCCACAC TGCCCCACCA GCTCGACCCA GCTTTCTTGT 1201 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1261 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1321 GAAAGGACGA TCTCACCTCT CGCATGTTCC AAAGACGCGT TAAGTCgaca atcaacctct 1381 ggattacaaa atttgtgaaa gatt