Transcript: Human XR_940505.2

PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase I (CAMK1), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CAMK1 (8536)
Length:
1333
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_940505.2
NBCI Gene record:
CAMK1 (8536)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_940505.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000676 CTACCACTCCTCACTGCATTT pLKO.1 1253 3UTR 100% 10.800 7.560 N CAMK1 n/a
2 TRCN0000196894 GATACAGCTCTAGATAAGAAT pLKO.1 861 3UTR 100% 5.625 3.938 N CAMK1 n/a
3 TRCN0000000677 CGGAGGACATTAGAGACATCT pLKO.1 177 3UTR 100% 4.950 3.465 N CAMK1 n/a
4 TRCN0000010001 GGCGGAGGACATTAGAGACAT pLKO.1 175 3UTR 100% 4.950 3.465 N CAMK1 n/a
5 TRCN0000010002 AGAAGATAAGAGGACGCAGAA pLKO.1 250 3UTR 100% 4.050 2.835 N CAMK1 n/a
6 TRCN0000055430 AGAAGATAAGAGGACGCAGAA pLKO.1 250 3UTR 100% 4.050 2.835 N CAMK1 n/a
7 TRCN0000000679 GCTGGATGCTGTGAAATACCT pLKO.1 514 3UTR 100% 3.000 2.100 N CAMK1 n/a
8 TRCN0000000678 GCTCTTTGACCGTATTGTGGA pLKO.1 445 3UTR 100% 2.640 1.848 N CAMK1 n/a
9 TRCN0000196989 GCCATCAAATGCATTGCCAAG pLKO.1 278 3UTR 100% 2.250 1.575 N CAMK1 n/a
10 TRCN0000010000 CCAGTCGGTGAGTGAGCAGAT pLKO.1 887 3UTR 100% 1.350 0.945 N CAMK1 n/a
11 TRCN0000009994 TACACCGGGATCTCAAGCCAG pLKO.1 552 3UTR 100% 0.720 0.504 N CAMK1 n/a
12 TRCN0000199962 CCTGTGGAACTCCGGGATACG pLKO.1 672 3UTR 100% 0.000 0.000 N CAMK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_940505.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01949 pDONR223 100% 68.9% None 1_139del;771_772ins113;1137_1333del n/a
2 ccsbBroad304_01949 pLX_304 0% 68.9% V5 1_139del;771_772ins113;1137_1333del n/a
3 TRCN0000488653 TCTCACCTCTCGCATGTTCCAAAG pLX_317 30.7% 68.9% V5 1_139del;771_772ins113;1137_1333delinsG n/a
4 TRCN0000489160 GAATCAGTCCCATGATTCGAGTGC pLX_317 30.9% 68.9% V5 (not translated due to prior stop codon) 1_139del;771_772ins113;1137_1333del n/a
5 TRCN0000489809 GACGTTCACGAACTCCTATGTTGC pLX_317 38.6% 68.8% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_14901 pDONR223 100% 68.6% None (many diffs) n/a
7 ccsbBroad304_14901 pLX_304 0% 68.6% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000471653 TATAACTGCTAGCAGGATTGGGAT pLX_317 34.2% 68.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV