Transcript: Human NM_003656.5

Homo sapiens calcium/calmodulin dependent protein kinase I (CAMK1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CAMK1 (8536)
Length:
1453
CDS:
149..1261

Additional Resources:

NCBI RefSeq record:
NM_003656.5
NBCI Gene record:
CAMK1 (8536)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003656.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009995 GAAGGCCGAGTACGAGTTTGA pLKO.1 841 CDS 100% 4.950 6.930 N CAMK1 n/a
2 TRCN0000024385 CCAAACTCTTTGAACAGATTT pLKO.1 819 CDS 100% 13.200 9.240 N Camk1 n/a
3 TRCN0000319709 CCAAACTCTTTGAACAGATTT pLKO_005 819 CDS 100% 13.200 9.240 N Camk1 n/a
4 TRCN0000000676 CTACCACTCCTCACTGCATTT pLKO.1 1375 3UTR 100% 10.800 7.560 N CAMK1 n/a
5 TRCN0000196894 GATACAGCTCTAGATAAGAAT pLKO.1 983 CDS 100% 5.625 3.938 N CAMK1 n/a
6 TRCN0000000677 CGGAGGACATTAGAGACATCT pLKO.1 186 CDS 100% 4.950 3.465 N CAMK1 n/a
7 TRCN0000010001 GGCGGAGGACATTAGAGACAT pLKO.1 184 CDS 100% 4.950 3.465 N CAMK1 n/a
8 TRCN0000010002 AGAAGATAAGAGGACGCAGAA pLKO.1 259 CDS 100% 4.050 2.835 N CAMK1 n/a
9 TRCN0000055430 AGAAGATAAGAGGACGCAGAA pLKO.1 259 CDS 100% 4.050 2.835 N CAMK1 n/a
10 TRCN0000199484 GCGGTTACCCTCCCTTCTATG pLKO.1 786 CDS 100% 3.600 2.520 N CAMK1 n/a
11 TRCN0000000679 GCTGGATGCTGTGAAATACCT pLKO.1 523 CDS 100% 3.000 2.100 N CAMK1 n/a
12 TRCN0000000678 GCTCTTTGACCGTATTGTGGA pLKO.1 454 CDS 100% 2.640 1.848 N CAMK1 n/a
13 TRCN0000196989 GCCATCAAATGCATTGCCAAG pLKO.1 287 CDS 100% 2.250 1.575 N CAMK1 n/a
14 TRCN0000010000 CCAGTCGGTGAGTGAGCAGAT pLKO.1 1009 CDS 100% 1.350 0.945 N CAMK1 n/a
15 TRCN0000009994 TACACCGGGATCTCAAGCCAG pLKO.1 561 CDS 100% 0.720 0.504 N CAMK1 n/a
16 TRCN0000199962 CCTGTGGAACTCCGGGATACG pLKO.1 681 CDS 100% 0.000 0.000 N CAMK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003656.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01949 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01949 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000489160 GAATCAGTCCCATGATTCGAGTGC pLX_317 30.9% 100% 100% V5 (not translated due to prior stop codon) n/a
4 TRCN0000488653 TCTCACCTCTCGCATGTTCCAAAG pLX_317 30.7% 99.9% 99.7% V5 1110_1111insG n/a
5 TRCN0000489809 GACGTTCACGAACTCCTATGTTGC pLX_317 38.6% 99.9% 99.7% V5 (not translated due to prior stop codon) 149G>A n/a
6 ccsbBroadEn_14901 pDONR223 100% 99.4% 62.9% None (many diffs) n/a
7 ccsbBroad304_14901 pLX_304 0% 99.4% 62.9% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000471653 TATAACTGCTAGCAGGATTGGGAT pLX_317 34.2% 99.4% 62.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV