Construct: ORF TRCN0000488664
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021989.1_s317c1
- DNA Barcode:
- TATTCGTGAGCATATAGGTTTATT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- NPY2R (4887)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488664
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4887 | NPY2R | neuropeptide Y receptor Y2 | NM_000910.4 | 99.3% | 99.4% | (many diffs) |
| 2 | human | 4887 | NPY2R | neuropeptide Y receptor Y2 | NM_001370180.1 | 99.3% | 99.4% | (many diffs) |
| 3 | human | 4887 | NPY2R | neuropeptide Y receptor Y2 | XM_005263033.4 | 99.3% | 99.4% | (many diffs) |
| 4 | mouse | 18167 | Npy2r | neuropeptide Y receptor Y2 | NM_008731.3 | 87.1% | 93.7% | (many diffs) |
| 5 | mouse | 18167 | Npy2r | neuropeptide Y receptor Y2 | XM_006501115.1 | 87.1% | 93.7% | (many diffs) |
| 6 | mouse | 18167 | Npy2r | neuropeptide Y receptor Y2 | XM_006501116.1 | 87.1% | 93.7% | (many diffs) |
| 7 | mouse | 18167 | Npy2r | neuropeptide Y receptor Y2 | NM_001205099.1 | 60.8% | 65.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1212
- ORF length:
- 1143
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat gggtccaata ggtgcagagg ctgatgagaa ccagacagtg gaagaaatga 121 aggtggaaca atacgggcca caaacaactc ctagaggtga actggtccct gaccctgagc 181 cagagcttat agatagtacc aagctgattg aggtacaagt tgttctcata ttggcctact 241 gctccatcat cttgcttggg gtaattggca actccttggt gatccatgtg gtgatcaaat 301 tcaagagcat gcgcacagta accaactttt tcattgccaa tctggctgtg gcagatcttt 361 tggtgaacac tctgtgtcta ccgttcactc ttacctatac cttaatggga gagtggaaaa 421 tgggtcctgt cctgtgccac ctggtgccct atgcccaggg cctggcagta caagtatcca 481 caatcacctt gacagtaatt gccctggacc ggcacaggtg catcgtctac cacctagaga 541 gcaagatctc caagcgaatc agcttcctga ttattggctt ggcctggggc atcagtgccc 601 tgctggcaag tcccctggcc atcttccggg agtattcgct gattgagatc attccggact 661 ttgagattgt ggcctgtact gaaaagtggc ctggcgagga gaagagcatc tatggcactg 721 tctatagtct ttcttccttg ttgatcttgt atgttttgcc tcttggcatt atatcatttt 781 cctacactcg catttggagt aaattgaaga accatgtcag tcctggagct gcaaatgacc 841 actaccatca gcgaaggcaa aaaaccacca aaatgctggt gtgtgtggtg gtggtgtttG 901 CGGTCAGCTG GCTGCCTCTC CATGCCTTCC AGCTTGCCGT TGACATTGAC AGCCAGGTCC 961 TGGACCTGAA GGAGTACAAA CTCATCTTCA CAGTGTTCCA CATTATCGCC ATGTGCTCCA 1021 CTTTTGCCAA TCCCCTTCTC TATGGCTGGA TGAACAGCAA CTACAGAAAG GCTTTCCTCT 1081 CGGCCTTCCG CTGTGAGCAG CGGTTGGATG CCATTCACTC TGAGGTGTCC GTGACATTCA 1141 AGGCTAAAAA GAACCTGGAG GTCAGAAAGA ACAGTGCTCC CAATGACTCT TTCACAGAGG 1201 GCACCAATGT CTAGGACCCA GCTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1261 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1321 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA TATTCGTGAG CATATAGGTT 1381 TATTACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt